Analysis of Interaction between Dendriplexes and Bovine Serum Albumin
Authors:
- Dzmitry ShcharbinDSDzmitry Shcharbin
- Elzbieta PedziwiatrEPElzbieta Pedziwiatr
- Louis ChoncoLCLouis Chonco
- Jesus F. Bermejo-MartínJBJesus F. Bermejo-Martín
- Paula OrtegaPOPaula Ortega
- F. Javier de la MataFMF. Javier de la Mata
- Ramon EritjaRamon Eritja
- Barbara KlajnertBarbara Klajnert
- Maria BryszewskaMBMaria Bryszewska
- M Angeles Muñoz-FernandezM Angeles Muñoz-Fernandez
- 21 June 2007
- journal article
- Published by American Chemical Society (ACS) in Biomacromolecules
- Vol. 8 (7) , 2059-2062
Abstract
Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the dendrimer/ODN dendriplexes ranged from 4 to 7. The efficiency of formation and stability of the dendriplexes depended on electrostatic interactions between the dendrimer and the ODNs. Dendriplex formation significantly decreased the interactions between ODNs and albumin. Thus, the formation of dendriplexes between carbosilane dendrimers and ODNs may improve ODN delivery.Keywords
This publication has 12 references indexed in Scilit:
- Cationic compounds used in lipoplexes and polyplexes for gene deliveryJournal of Controlled Release, 2004
- Water-Soluble Polycationic Dendrimers with a Phosphoramidothioate Backbone: Preliminary Studies of Cytotoxicity and Oligonucleotide/Plasmid Delivery in Human Cell CultureOligonucleotides, 2003
- Fluorescence studies on PAMAM dendrimers interactions with bovine serum albuminBioelectrochemistry, 2002
- Overcoming the inhibitory effect of serum on lipofection by increasing the charge ratio of cationic liposome to DNAGene Therapy, 1997
- Interaction of Oligodeoxynucleotides with Mammalian CellsAntisense and Nucleic Acid Drug Development, 1996
- Characterization of Binding Sites, Extent of Binding, and Drug Interactions of Oligonucleotides with AlbuminAntisense Research and Development, 1995
- Bovine Serum Albumin Is a Major Oligonucleotide-Binding Protein Found on the Surface of Cultured CellsAntisense Research and Development, 1995
- Influence of liposome charge and composition on their interaction with human blood serum proteinsMolecular and Cellular Biochemistry, 1993
- Synthesis of carbocyclic analogs of 2-deoxy-KdoThe Journal of Organic Chemistry, 1990
- Polymer support oligonucleotide synthesis XVIII1.2): use ofβ-cyanoethyi-N,N-dialkylamino-/N-morpholino phosphoramidite of deoxynucleosides for the synthesis of DNA fragments simplifying deprotection and isolation of the final productNucleic Acids Research, 1984