Antonella Virgilio

G-quadruplex (G4) DNA structures have recently emerged as promising chiral scaffolds for enantioselective catalysis. This study investigates how thymidine loop modifications influence the catalytic performance of the telomeric G4 sequence HT21 in the asymmetric sulfoxidation of thioanisole. To this end, several singly or doubly modified HT21 derivatives were synthesized by using β-L-2′-deoxythymidine, 5-hydroxymethyl-2′-deoxyuridine, and 5-bromo-2′-deoxyuridine instead of a T residue, or β-L-2′-deoxyadonesine instead of an A residue, in specific positions within the TTA loops. The catalytic activity of these analogues was evaluated in the Cu(II)-mediated oxidation of thioanisole using hydrogen peroxide as oxidant. All modified sequences maintained complete substrate conversion, but their enantioselectivities varied markedly. Whereas the highest enantiomeric excess (84% ee) had previously been achieved with the HT21 analogue bearing a β-L-2′-deoxyadenosine in the first loop, the thymidine-based modifications, either alone or in combination, resulted in lower ee values, suggesting that loop alterations critically affect the chiral microenvironment, not all loop positions are functionally equivalent, and single substitutions within the same loop can result in different enantioselectivities. These findings highlight new insights on how individual loop residues contribute to asymmetric induction and offer further details for tuning G4-based catalytic scaffolds.

T40214 (STAT) and its recently investigated analogue STATB are G-quadruplex (G4) forming aptamers characterized by an unusually high percentage of C. The therapeutic potential of T40214 relies on its ability to inhibit the signalling pathway of STAT3, a protein frequently overexpressed in tumor cells. STAT adopts a dimeric 5′-5′ end-stacked quadruplex structure, characterized by parallel strands, three G-tetrads and three propeller-shaped loops formed by a cytidine residue. STATB folds in a very similar structure, apart from an additional cytidine bulge loop. Many studies suggest that thermal stability and topology of G4 can be significantly affected by C methylation, thus resulting in altered interaction of G4-binding proteins with these structures. Considering this, two series of STAT and STATB analogues containing a single 5-methyl-2′-deoxycytidine (mC) residue instead of canonical C nucleotide in the loop have been prepared and investigated by a combination of spectroscopic and electrophoretic techniques. CD, NMR and PAGE data clearly indicate that all derivatives adopt dimeric G4 strictly similar to that assumed by parent aptamers, but with higher stabilities. Furthermore, the resistance to nucleases and the antiproliferative activity of these mC-containing derivatives against HCT116 (human colorectal carcinoma) and T24 (human bladder carcinoma) cell lines have been evaluated. In most of the cases, STAT and STATB derivatives inhibit cell proliferation to different extents, although to a lesser degree than the unmodified parent sequences. All the data highlight the key role of the loops and indicate mC as a useful tool to contribute favorably to the stability of G4-forming aptamers without alteration of their topology, required for the biological activity.

Thrombin binding aptamer (TBA) is one of the best-known G-quadruplex (G4)-forming aptamers that efficiently binds to thrombin, resulting in anticoagulant effects. TBA also possesses promising antiproliferative properties. As with most therapeutic oligonucleotides, chemical modifications are critical for therapeutic applications, particularly to improve thermodynamic stability, resistance in biological environment, and target affinity. To evaluate the effects of nucleobase and/or sugar moiety chemical modifications, five TBA analogues have been designed and synthesized considering that the chair-like G4 structure is crucial for biological activity. Their structural and biological properties have been investigated by Circular Dichroism (CD), Nuclear Magnetic Resonance (NMR), native polyacrylamide gel electrophoresis (PAGE) techniques, and PT and MTT assays. The analogue TBAB contains 8-bromo-2′-deoxyguanosine (B) in G-syn glycosidic positions, while TBAL and TBAM contain locked nucleic acid guanosine (L) or 2′-O-methylguanosine (M) in G-anti positions, respectively. Instead, both the two types of modifications have been introduced in TBABL and TBABM with the aim of obtaining synergistic effects. In fact, both derivatives include B in syn positions, exhibiting in turn L and M in the anti ones. The most appealing results have been obtained for TBABM, which revealed an interesting cytotoxic activity against breast and prostate cancer cell lines, while in the case of TBAB, extraordinary thermal stability (T_m approximately 30 °C higher than that of TBA) and an anticoagulant activity higher than original aptamer were observed, as expected. These data indicate TBAB as the best TBA anticoagulant analogue here investigated and TBABM as a promising antiproliferative derivative.

Thrombin-binding aptamer (TBA) is one of the best-known G-quadruplex (G4)-forming aptamers. By adopting its peculiar chair-like G4 structure, TBA can efficiently bind to thrombin, thus producing an anticoagulant effect. The major limit to its therapeutic application is represented by its poor thermal and biological resistance. Therefore, numerous research studies have been focused on the design of TBA analogues with chemical modifications to improve its pharmacokinetic and pharmacodynamic properties. To maintain the functional recognition to protein surface on which TBA anticoagulant activity depends, it is essential to preserve the canonical antiparallel topology of the TBA quadruplex core. In this paper, we have designed three TBA variants with modified G-tetrads to evaluate the effects of nucleobase and sugar moiety chemical modifications on biological properties of TBA, preserving its chair-like G-quadruplex structure. All derivatives contain 8-bromo-2′-deoxyguanosine (G^Br) in syn positions, while in the anti-positions, locked nucleic acid guanosine (G^LNA) in the analogue TBABL, 2’-O-methylguanosine (G^OMe) in TBABM, and 2’-F-riboguanosine (G^F) in TBABF is present. CD (Circular Dichroism), CD melting, 1H-NMR (Nuclear Magnetic Resonance), and non-denaturing PAGE (Polyacrylamide Gel Electrophoresis), nuclease stability, prothrombin time (PT) and fibrinogen-clotting assays have been performed to investigate the structural and biological properties of these TBA analogues. The most interesting results have been obtained with TBABF, which revealed extraordinary thermal stability (T_m approximately 40 °C higher than that of TBA), anticoagulant activity almost doubled compared to the original aptamer, and, above all, a never-observed resistance to nucleases, as 50% of its G4 species was still present in 50% FBS at 24 h. These data indicate TBABF as one of the best TBA analogue ever designed and investigated, to the best of our knowledge, overcoming the main limitations to therapeutic applications of this aptamer.

In this paper, we investigate the structural and biological features of G-quadruplex (G4) aptamers as promising antiproliferative compounds affecting the STAT3 signalling pathway. Targeting the STAT3 protein through high-affinity ligands to reduce its levels or activity in cancer has noteworthy therapeutic potential. T40214 (STAT) [(G₃C)₄] is a G4 aptamer that can influence STAT3 biological outcomes in an efficient manner in several cancer cells. To explore the effects of an extra cytidine in second position and/or of single site-specific replacements of loop residues in generating aptamers that can affect the STAT3 biochemical pathway, a series of STAT and STATB [GCG₂(CG₃)₃C] analogues containing a thymidine residue instead of cytidines was prepared. NMR, CD, UV, and PAGE data suggested that all derivatives adopt dimeric G4 structures like that of unmodified T40214 endowed with higher thermal stability, keeping the resistance in biological environments substantially unchanged, as shown by the nuclease stability assay. The antiproliferative activity of these ODNs was tested on both human prostate (DU145) and breast (MDA-MB-231) cancer cells. All derivatives showed similar antiproliferative activities on both cell lines, revealing a marked inhibition of proliferation, particularly at 72 h at 30 µM. Transcriptomic analysis aimed to evaluate STAT’s and STATB’s influence on the expression of many genes in MDA-MB-231 cells, suggested their potential involvement in STAT3 pathway modulation, and thus their interference in different biological processes. These data provide new tools to affect an interesting biochemical pathway and to develop novel anticancer and anti-inflammatory drugs.

In this paper, we study the biological properties of two TBA analogs containing one and two extra G-tetrads, namely TBAG3 and TBAG4, respectively, and two further derivatives in which one of the small loops at the bottom (TBAG41S) or the large loop at the top (TBAG4GS) of the TBAG4 structure has been completely modified by replacing all loop residues with abasic site mimics. The therapeutical development of the TBA was hindered by its low thermodynamic and nuclease stability, while its potential as an anticancer/antiproliferative molecule is also affected by the anticoagulant activity, being a side effect in this case. In order to obtain suitable TBA analogs and to explore the involvement of specific aptamer regions in biological activity, the antiproliferative capability against DU 145 and MDAMB 231 cancer cell lines (MTT), the anticoagulant properties (PT), the biological degradability (nuclease stability assay) and nucleolin (NCL) binding ability (SPR) of the above described TBA derivatives have been tested. Interestingly, none of the TBA analogs exhibits an anticoagulant activity, while all of them show antiproliferative properties to the same extent. Furthermore, TBAG4 displays extraordinary nuclease stability and promising antiproliferative properties against breast cancer cells binding NCL efficiently. These results expand the range of G4-structures targeting NCL and the possibility of developing novel anticancer and antiviral drugs.

In this paper, we study the T30923 antiproliferative potential and the contribution of its loop residues in six different human cancer cell lines by preparing five T30923 variants using the single residue replacement approach of loop thymidine with an abasic site mimic (S). G-rich oligonucleotides (GRO) show interesting anticancer properties because of their capability to adopt G-quadruplex structures (G4s), such as the G4 HIV-1 integrase inhibitor T30923. Considering the multi-targeted effects of G4-aptamers and the limited number of cancer cell lines tested, particularly for T30923, it should be important to find a suitable tumor line, in addition to considering that the effects also strictly depend on G4s. CD, NMR and non-denaturating polyacrylamide gel electrophoresis data clearly show that all modified ODNs closely resemble the dimeric structure of parallel G4s’ parent aptamer, keeping the resistance in biological environments substantially unchanged, as shown by nuclease stability assay. The antiproliferative effects of T30923 and its variants are tried in vitro by MTT assays, showing interesting cytotoxic activity, depending on time and dose, for all G4s, especially in MDA-MB-231 cells with a reduction in cell viability approximately up to 30%. Among all derivatives, QS12 results are the most promising, showing more pronounced cytotoxic effects both in MDA-MB-231 and Hela cells, with a decrease in cell viability from 70% to 60%. In summary, the single loop residue S substitution approach may be useful for designing antiproliferative G4s, considering that most of them, characterized by single residue loops, may be able to bind different targets in several cancer cell pathways. Generally, this approach could be of benefit by revealing some minimal functional structures, stimulating further studies aimed at the development of novel anticancer drugs.

The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2′-deoxyadenosine (A^Br), 8-oxo-2′-deoxyadenosine (A^oxo) or β-L-2′-deoxyadenosine (A^L) at different single loop positions were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The substitution of an adenosine in the loops of HT21 with these modified residues had a negligible impact on the G4 DNA structural features, thermal stability, and catalytic activity, since almost all investigated ODNs were able to form G-quadruplexes strictly resembling that of HT21 and catalyze a full conversion of the thioanisole substrate. More marked effects were obtained in chiral selectivity of G4 DNA metalloenzymes, considering that in most cases the DNA-modified catalysts induced lower enantioselectivities compared to the natural one. However, the HT21 derivative containing an A^L residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess, the highest enantioselectivity for DNA-based oxidation reaction to date.