Peng Li

The rhizosphere microbiota plays a vital role in plant stress resistance and pathogen suppression. Bacterial wilt, caused by Ralstonia solanacearum , leads to significant economic losses in a wide variety of crops. The utilization of native microbial consortia has emerged as a promising strategy for combating this disease. In this study, we assembled a synthetic microbial consortium (Co-4) from rhizosphere bacteria with demonstrated antagonistic activity, comprising four strains of Bacillus sp., Heyndrickxia sp., Franconibacter sp., and Pseudomonas sp. Transcriptome analysis of tomato plants treated with Co-4 revealed significant alterations in gene expression, particularly in carbohydrate and energy metabolism, as well as translation processes. These changes correlated with enhancements in various plant growth traits, including height, stem thickness, biomass, leaf area, photosynthetic rate, and root development. Furthermore, two simplified consortia, SynCom1 ( Bacillus , Heyndrickxia , and Franconibacter ) and SynCom2 ( Franconibacter and Pseudomonas ), exhibited augmented antagonistic properties against R. solanacearum compared with their individual constituent strains. Using SynCom2 as a model, we demonstrated that its synergistic interactions resulted in increased biofilm formation, motility, biomass production, cross-feeding interactions, and volatile organic compound emissions, all of which likely contribute to disease suppression and enhanced plant defense. This study highlights the potential of simplified synthetic consortia for managing bacterial wilt through cooperative microbial functions, presenting an effective and environmentally sustainable biocontrol strategy.

Cross-kingdom virus transmission between plants and fungi remains rare in nature. Here, a novel circular ssDNA virus, Diaporthe pseudophoenicicola DNA virus 1 (DpDV1), was identified from the phytopathogenic fungus Diaporthe pseudophoenicicola. DpDV1 attenuates the pathogenicity of both its original and experimental host fungi, demonstrating its potential as a biocontrol agent against fungal phytopathogens. Remarkably, DpDV1 displays bidirectional plant-fungal transmission capability without inducing observable phenotypic changes in plant hosts, overcoming the limitations imposed by vegetative incompatibility in conventional hypovirulence-based biocontrol approaches. Immunocytochemical localization assays revealed DpDV1 is localized in the chloroplasts of plant cells, demonstrating its cross-kingdom transmission. Furthermore, we demonstrated DpDV1 can cross-protect plants against plant viruses, establishing foundations for cross-protection-based management of plant virus diseases. Hence, we report a novel ssDNA mycovirus and provide evidence of mycovirus cross-kingdom transmission between plant and fungi, providing innovative strategies for mycovirus biocontrol of plant fungal and viral diseases.

The quorum‐sensing (QS) system plays a crucial role in regulating the virulence of the Ralstonia solanacearum species complex (RSSC). It is controlled by the phcBSR operon and phcA genes. PhcQ may contribute to the activation of PhcA and regulates the expression of QS‐dependent genes. Here, we genetically demonstrate that PhcQ functions as a key component of the QS regulatory pathway by maintaining the protein stability of PhcA in R. pseudosolanacearum OE1‐1. Deletion of phcQ significantly increased the expression of genes encoding the type III secretion system but decreased the expression of genes for the synthesis of exopolysaccharide, consistent with that of PhcA. The phcQ mutants exhibited enhanced growth at early stages and retained weak virulence on tobacco plants, although they are nonvirulent on tomato plants. Using an overexpression system, we positioned PhcQ downstream of PhcB and upstream of PhcA in the QS regulatory cascade. PhcQ did not affect phcA transcription, while proteomic analysis and western blot revealed that PhcQ maintains PhcA protein stability, with PhcA protein levels reduced to approximately 41% in phcQ mutants. Further structural analysis revealed a disordered tail within the C‐terminus of PhcA that is dispensable for PhcA function yet critical for protein stability. Using bimolecular fluorescence complementation and GST pull‐down assay, we demonstrated that PhcQ binds directly to PhcA both in vitro and in planta , and deletion of this C‐terminus tail impaired their binding affinity. These findings reveal a novel regulatory mechanism where PhcQ binds to PhcA and maintains its protein stability to ensure proper QS‐dependent gene regulation in RSSC.

Urbanization reshapes soil ecosystems, yet its impacts on the composition and interactions of soil microbial communities remain insufficiently understood. Here, we use high-throughput sequencing to profile bacteria, fungi, and protists across four representative habitat types of different urbanization level—campuses, roadside greenbelts, suburban unmanaged lands, and concrete pavements in four Chinese cities spanning a broad latitudes (Changchun, Beijing, Hangzhou, Haikou). Vegetated habitats consistently structure microbial communities, whereas concrete pavements form a distinct disturbed habitat with the lowest microbial richness. Bacterial richness is highest in campuses and roadside greenbelts, while fungal and protistan richness peaks in suburban unmanaged lands. Despite regional variation, communities under similar vegetation types show convergent compositions, jointly shaped by regional climate and land-use intensity. Bacterial assemblages are more sensitive to environmental variation than fungi and protists. Proteobacteria dominate bacteria communities, whereas fungal and protistan communities display marked habitat specificity. Co-occurrence networks complexity peaks in roadside greenbelts, remains stable in suburban unmanaged lands and collapses significantly in concrete pavements. Microbial diversity patterns are strongly associated with temperature, soil pH, and latitude. Together, these results demonstrate that environmental conditions and urbanization intensity drive the biogeography and interaction patterns of soil microbiomes, providing insights for ecological restoration and urban green-space management.

The pathogen Dickeya oryzae is responsible for soft rot disease in both monocotyledonous and dicotyledonous plants, resulting in substantial yield losses across a variety of important crops. However, the molecular mechanisms and signalling pathways that regulate bacterial virulence remain poorly understood. In this study, we identified a conserved transcriptional regulator, EmrR (multidrug efflux transporter EmrAB transcriptional repressor), in Dickeya species that plays a critical role in controlling cellular motility. Phenotypic analysis demonstrated that EmrR is also involved in the regulation of cellulase, as well as biofilm formation. emrR deletion mutants displayed markedly decreased virulence in rice seed germination and potato tubes. Further investigation revealed that EmrR negatively regulates the expression of genes encoding the type III secretion system by decreasing the intracellular concentration of c‐di‐GMP (bis‐(3′‐5′)‐cyclic dimeric guanosine monophosphate) and also modulates the key regulatory gene hrpL within this system. DNase I footprinting confirmed that EmrR binds specifically to a sequence (5′‐CATTCGTTACTATGCAGGTTG‐3′) in the emrR promoter region. This finding highlights EmrR as a conserved and essential regulator of virulence in Dickeya , providing novel insights into the complex signalling and regulatory networks that regulate physiological processes, biochemical mechanisms and virulence development in this pathogen.

The Ralstonia solanacearum species complex (RSSC) ranks among the most destructive plant pathogens worldwide, due to its broad host range, extensive geographic distribution and remarkable environmental adaptability. Its persistence in soil and colonization of plant vascular tissues severely limits the effectiveness of conventional chemical control, posing significant challenges for disease management. This review highlights recent advances in understanding the environmental adaptation mechanisms of RSSC. Key topics include the dynamic evolution of pathogenicity, niche‐specific survival strategies and virulence regulation mediated by quorum sensing, and complex interactions with surrounding microbial communities that shape its behaviour and fitness. We further provide a comprehensive assessment of current control strategies from an ecological perspective, encompassing physical, chemical, genetic, agronomic and microbial approaches, with critical evaluation of their mechanisms, potential and limitations. Meanwhile, we discuss the major challenges in bacterial wilt management and outline future directions, with an emphasis on multi‐omics‐informed precision breeding, microbiome engineering and intelligent integrated disease management (IDM). These emerging strategies hold promise for the sustainable and effective long‐term control of bacterial wilt disease caused by RSSC.

The coordinated post-natal development of the gut microbiome and metabolome is essential for preterm infant health, yet its disruption is increasingly linked to adverse outcomes such as bronchopulmonary dysplasia (BPD). In this study, we performed an integrated multiomics analysis of fecal samples collected from preterm infants to characterize temporal changes in gut microbial and metabolic profiles and explore their potential associations with BPD development. This study observed a distinct trajectory of the phylum Bacteroidota as a hallmark of normal gut maturation, with its abundance progressively declining across non-BPD infants. In contrast, infants who later developed BPD exhibited early depletion followed by irregular enrichment of Bacteroidota. Correlation analysis revealed that Streptococcus abundance was positively associated with elevated cysteic acid, a metabolite linked to oxidative stress. Together, these findings suggest that altered Bacteroidota succession and Streptococcus -associated oxidative imbalance may reflect early microbial-metabolic perturbations in infants at risk of BPD. This work provides preliminary, hypothesis-generating insights into gut-associated signatures potentially relevant to BPD pathogenesis. IMPORTANCE: Bronchopulmonary dysplasia (BPD) remains a leading cause of morbidity in preterm infants, yet early biomarkers and targeted preventive strategies are limited. By integrating microbiome and metabolome data from a pilot cohort, this study identified patterns of disrupted Bacteroidota succession and Streptococcus -associated oxidative stress that are associated with BPD risk. These findings highlight the gut as a potential extrapulmonary contributor to disease susceptibility and support early risk assessment and guide future microbiome-targeted interventions in preterm infants.

Biological invasions pose a major threat to ecosystem stability, yet the role of rhizosphere microbiomes in conferring competitive advantages to invasive p

The egret activities, including the deposition of feces and feathers, significantly alter soil properties and the local ecosystem. Two villages of Hainan Province serve as “the haven of egret,” a crucial habitat along the migratory route of egrets in China, where tens of thousands of egrets flock to breed. To explore the spatial dynamics of soil bacterial diversity in egret nesting areas, soil samples of three layers (0–10 cm, 10–20 cm, and 20–30 cm) were collected from five long-term nesting sites. Soil enzyme activity, microbial community composition, and their interaction network were analyzed. Additionally, functional bacteria capable of degrading uric acid were isolated from the surface soil (0–10 cm) to obtain novel strains. The results revealed that soil enzyme activities, including soil urease, acid phosphatase, and sucrase, decreased significantly with increasing soil depth. Among the bacterial communities, Acidobacteriota and Proteobacteria were the dominant microbial phyla (>40%), with Chloroflexi showing increasing abundance with depth, while Verrucomicrobiota and Bacteroidota decreased. Surface soil (0–10 cm) demonstrated significantly higher bacterial alpha and beta diversity than deeper layers (20–30 cm); notably, the Shannon index exhibited a positive correlation with soil pH, urease, and sucrase activities, highlighting the strong association between bacterial diversity and soil properties. Furthermore, five highly effective uric acid-degrading bacterial strains belonging to Cellulosimicrobium sp., Paracoccus sp., Arthrobacter sp. (two strains), and Paenibacillus sp. were identified, which highlights their potential in ecological and economic applications. These findings enhance our understanding of soil bacterial community characteristics in egret colonies and provide a foundation for the habitat protection of egrets and island ecosystems. IMPORTANCE: Egret colony activities have a significant impact on soil bacterial community structure, which is essential for maintaining soil nutrient dynamics and ecological functions. Understanding the spatial distribution characteristics of bacterial communities is fundamental to effective ecological monitoring and conservation. Both alpha and beta diversity exhibited significant variations across different soil layers and showed a strong positive correlation with soil enzyme activity, indicating that soil bacterial diversity is a key driver of nutrient efficiency.

Background: Due to the excellent invasive ability, the plant Sphagneticola trilobata p oses a severe threat to local ecosystems . We hypothesized that its invasive success is highly related to its ability of shaping a beneficial rhizosphere microbiome. To test this, we compared the rhizosphere bacterial communities of S. trilobata (SRS) and a common greening grass Axonopus compressus (ARS). Result: We found that S. trilobata cultivates a significantly more diverse and structurally distinct bacterial community, enriched with key taxa (Rhizobiales, Cytophagales, Pseudomonadaceae, Comamonadaceae, and Novosphingobium ) that are known as the groups associated with nitrogen fixation and plant growth promotion, and exhibited a more complex and cooperative interaction network than ARS. Functional predictions indicated an enhanced capacity for lipid and carbohydrate metabolism in SRS, suggesting efficient nutrient cycling around its rhizosphere. Crucially, a synthetic community (SynCom) constructed from SRS-enriched bacteria promoted the biomass of S. trilobata significantly and altered resource allocation towards roots under nutrient-poor conditions. Conclusion: Our findings provide strong evidence that S. trilobata engineers a specialized rhizosphere microbiome that confers direct competitive advantage compared with other local plants, revealing a key microbial mechanism underlying its successful invasion.