Yi Zhen Deng

Sugarcane smut is one of the most devastating fungal diseases affecting sugarcane plantations. The virulence of the causative agent, Sporisorium scitamineum , depends on a process called sexual mating of compatible sporidia MAT-1 and MAT-2 to form infectious dikaryotic hyphae. We previously isolated Pseudomonas shiyinii strain ST4, capable of inhibiting the fungal sexual mating. However, its biocontrol mechanism remains unclear. In this study, Tn5 mutagenesis of strain ST4 led to the identification of a number of genes potentially associated with the biosynthesis of mating inhibitors. Among them, a two-component system GacS/GacA was found responsible for the inhibitory activity against fungal mating. Transcriptomic and genetic analyses unveiled that GacS/GacA positively regulates a novel gene cluster designated as mib1 (mating inhibitor biosynthesis 1), consisting of seven genes. Compared with the parental strain ST4, the mib1 deletion mutants were much compromised in the anti-mating activity. Two LysR-family transcriptional regulators, located adjacent to the mib1 gene cluster, were also shown to play key roles in regulating mib1 transcription and biosynthesis of mating inhibitor(s). In summary, the results from this study uncovered a novel gene cluster, the two-component system GacS/GacA, and two transcriptional factors associated with the regulation and biosynthesis of inhibitory compound(s) against S. scitamineum sexual mating. The findings depict the genetic regulatory network that controls the biocontrol potency of Pseudomonas shiyinii ST4 and present useful clues for identification of its anti-mating inhibitor(s). IMPORTANCE: Sporisorium scitamineum is the major sugarcane pathogen that causes tremendous economic losses internationally. The sporidia sexual mating is vital for the fungus to form dikaryotic hyphae capable of infecting sugarcanes, thus is a highly attractive and promising target for screening of biocontrol agents and green chemical mating inhibitors against this devastating fungal pathogen. We previously reported that Pseudomonas shiyinii ST4 can inhibit the sexual mating of S. scitamineum without affecting its haploid sporidia growth. By using transposon mutagenesis in combination with genetic and bioinformatics analyses, this study aimed to identify the genetic components of strain ST4 associated with its biocontrol potency. The significance of this study is in (i) identifying a novel gene cluster mib1 involved in production of mating inhibitor(s) by strain ST4, (ii) demonstrating that the GacS/GacA-RsmY-CsrA regulatory cascade plays an essential role in regulation of the mib1 cluster and the bacterial anti-mating activity, and (iii) unveiling two novel transcription factors, that is, MibR1 and MibR2, which act downstream of the Gac regulatory cascade in modulation of the mib1 gene expression. The findings represent a critical step in depicting the biocontrol mechanisms of strain ST4 and provide valuable clues for further investigations.

Fungal pathogens secrete diverse effectors to suppress host immunity, yet the plant receptors that perceive these virulence factors often remain elusive. Here, we identify Ss1624, a secreted RNase from the sugarcane smut pathogen Sporisorium scitamineum , and show that it is recognized by the plasma-membrane-localized CrRLK1L-family receptor kinase RLK15. This recognition triggers canonical immune outputs, including reactive oxygen species burst, callose deposition, defense gene activation, and induces hypersensitive cell death. Mechanistically, Ss1624 physically interacts with the receptor-like kinase RLK15, which is required for Ss1624-triggered cell death. Functional assays indicate that this interaction enhances RLK15 autophosphorylation in a kinase activity-dependent manner, suggesting that Ss1624 can act as an elicitor. Transcript profiling further reveals coordinated expression patterns of Ss1624 and RLK15 during infection, and perturbation of Ss1624 expression alters RLK15 transcript levels and pathogenic outcomes. Extending these findings to rice, the ortholog OsRLK15 contributes positively to resistance to bacterial and fungal diseases without yield penalty in rice. Our results support a model in which a secreted RNase effector is directly sensed by a receptor kinase to initiate broad-spectrum immune responses, providing insights into host-pathogen interactions and identifying RLK15 as a candidate for crop improvement. Short Summary: A secreted RNase from Sporisorium scitamineum , is recognized by receptor kinase RLK15, triggering cell death and immunity. Ss1624 binds RLK15 and promotes its autophosphorylation in a kinase-activity-dependent manner. Transcript analysis reveals coordinated expression of the effector and receptor during infection. Notably, the rice ortholog OsRLK15 confers broad-spectrum disease resistance without yield penalty. These findings identify RLK15 as a conserved immune receptor for RNase-type effectors and a promising target for engineering durable crop resistance.

Ferroptotic death of the developing conidia is important for pathogenicity of the blast fungus Magnaporthe oryzae , yet its regulatory mechanism is not fully elucidated in fungal cell. In this study, we found that elevated indole‐3‐acetic acid (IAA) promoted iron and lipid peroxide accumulation, leading to a higher degree of ferroptotic death of conidia. By characterising the IAA biosynthesis mutant, tam1 Δ, we found that conidial death was positively correlated with levels of endogenous IAA. Furthermore, we found an IAA‐dependent lipid metabolism gene mutant ppoa Δ displayed deficiencies in conidial death and the consequent delay in appressorium formation, and reduced pathogenicity. Exogenous addition of two types of phosphatidylethanolamines (PEs), DOPE and SLPE, could at least partially restore such defects in both tam1 Δ and ppoa Δ, indicating that IAA promotes ferroptosis by affecting lipid metabolism and/or peroxidation. Additionally, we found TAM1 affected autophagy by modulating transcription of the ATG8 gene. Overall, our study reveals that M. oryzae produces and uses IAA to promote pathogenicity through triggering ferroptotic conidial death during pathogenic development. Our results provide a theoretical basis for blast disease control using IAA synthesis inhibitors.

Barnyard grass, a widespread and persistent weed in rice paddies, belongs to the same family as rice and may act as a bridge host for the rice blast fungus. This study utilized comparative genomics to analyze six Pyricularia oryzae strains isolated from barnyard grass (Baicao series) and rice (GDYJ7 and ZJX18), integrating pathogenicity assays, whole-genome sequencing, and functional annotation. Pathogenicity tests demonstrated host specificity, as Baicao series strains caused typical lesion symptoms on barnyard grass but not on rice leaves, while GDYJ7 and ZJX18 caused lesions mainly on rice. Genomic analyses indicated that Baicao series strains possessed larger genomes (41.04 Mb to 41.16 Mb) with a higher content of repetitive sequences (6.68% to 7.09%) compared to rice strains GDYJ7 and ZJX18 (38.69 Mb and 39.05 Mb; 3.66% and 3.71% repeats). Phylogenetic analysis confirmed that Baicao series strains represent a grass-infecting pathotype of P. oryzae species, as they were grouped with the established grass-isolated P. oryzae strains, while GDYJ7 and ZJX18 were grouped with rice-isolated P. oryzae strains. However, Baicao series, GDYJ7 and ZJX18 are all relatively distant from P. grisea species. PCR amplification revealed that Baicao series strains harbored significantly fewer avirulence genes (Avr-Pib, Avr-Pizt, PWL3) than GDYJ7 and ZJX18 (Avr-Pib, Avr-Pizt, Avr-Pi9, Avr-Pik, PWL2), with Baicao9 retaining only Avr-Pib. In summary, our results suggested that the genomic sequences of the barnyard grass-isolated strains serve as a valuable resource for the study of P. oryzae strains with differential host preference and provide novel insights into the evolution of pathogen genomes during host adaptation.

Rice is a major food crop in China as well as Asia, yet its production is threatened by microbial diseases including blast disease caused by fungal pathogen (Magnaporthe oryzae) and bacterial blight caused by several bacterial pathogens. To screen for bacterial microbiota associated with rice blast occurrence, and/or contributing to disease resistance, we performed microbiota analysis with rhizosphere soil, root, stem, and leaf samples of blast susceptible (CO39) and resistant (Y33R) rice grown in a blast disease nursery garden. Our result showed no significant difference in microbiota of rhizosphere soil, root, or leaf between these two rice cultivars, but stem microbiota were significantly different. Pantoea spp. were enriched in stem of blast susceptible rice, suggesting that it may play a role after fungal infection. A total of 822 bacterial strains were isolated from the phyllospheric (including leaf and stem) samples of Y33R and CO39 rice. Based on 16S rRNA amplicon sequencing, and phylogenic analysis using 16S rRNA, gyrB, leuS, and rpoB gene sequences, the 3 isolated strains and 1 strain were identified as P. ananatis and P. dispersa, respectively. The strains A25-H1 and B10-A1 were selected for genome sequencing, and based on Average Nucleotide Identity (ANI) analysis, we confirmed that A25-H1 was P. ananatis and B10-A1 was P. dispersa. The P. ananatis consortium (A25-F1, A25-G1, and A25-H1 combination) A25-11 and P. dispersa strain B10-A1 displayed suppressive effect on blast disease when they were applied to the susceptible rice CO39. Although a P. ananatis strain SC7 has been reported to cause bacterial blight in rice, A25-11 or B10-A1 was non-pathogenic to rice under experimental conditions. Furthermore, they could also suppress bacterial blight caused by SC7 or Xanthomonas oryzae pv. oryzae strain Pxo99A. A25-11 and B10-A1 did not affect the growth of M. oryzae mycelia in confrontation culture analysis, but induced transcription of rice immunity genes and promoted ROS accumulation, suggesting that the biocontrol effect of A25-11 or B10-A1 may lie on immunity priming. We further showed that A25-11 and B10-A1 possessed growth promoting capacity including indole 3-acetic acid (IAA) production, phosphate solubilization, nitrogen fixation, and siderophore production. Under field condition, the consortium A25-11 and strain B10-A1 could effectively suppress leaf and panicle blast. Overall, this study established a microbiome method for identifying the rice bacterial communities of agricultural significance, with capacity of rice disease management and/or growth promotion.

The basidiomycete Sporisorium scitamineum causes sugarcane smut disease, leading to a significant impairment in the quality and yield of sugarcane. Polyamines affect the intracellular redox balance, which is important for the pathogenic development of S. scitamineum, including sexual mating, dikaryotic hyphae growth, and host invasion. In the present study, we identified a polyamine transporter, SsTPO1, in S. scitamineum. Deletion or overexpression of SsTPO1 led to the disruption of intracellular levels of putrescine, spermidine, and spermine in opposite directions. SsTPO1-based polyamine homeostasis contributes to dikaryotic hyphal growth and host invasion after sexual mating, likely by affecting the cAMP-PKA signaling pathway and collaboratively regulating redox homeostasis. Environmental pH affected SsTPO1-mediated polyamine transport, so S. scitamineum hyphae growth favoured neutral to alkaline environments rather than acidic conditions. The SsTPO1-based polyamine transport also participates in stress resistance and autophagy induction. In summary, our work revealed that SsTPO1 facilitates polyamine transport to regulate cell growth, differentiation, and fungal pathogenicity in S. scitamineum.

The rice blast fungus, Magnaporthe oryzae, imposes a great threat to global food security. Autophagic cell death of conidium is essential for appressorium-mediated host invasion during pathogenesis. Our recent study revealed that ferroptosis, potentially regulated by macroautophagy/autophagy, is responsible for M. oryzae conidial death during appressorium formation and maturation. Here, we characterized the role of the iron exporter MoFpn1 (ferroportin 1) and show that its loss leads to increased intracellular iron levels, accelerated conidial death, and reduced sensitivity to liproxstatin-1, suggesting that MoFpn1 negatively regulates ferroptosis as an iron exporter in M. oryzae. In conidia, MoFpn1-mCherry fusion protein localized on punctate/vesicular organelles, largely overlapping with CMAC-stained vacuoles, and is subject to regulation by iron availability and autophagy. MoFpn1 was associated with Atg8, based on yeast two-hybrid (Y2H) and bimolecular fluorescence complementation (BiFC) assays. MoFpn1-mCherry partially colocalized with GFP-Atg8-tagged autophagosomes or autophagic vacuoles in developing conidia. Upon appressorium formation, MoFpn1-mCherry localized to the plasma membrane of appressoria. In mature appressorium, plasma membrane-localized MoFpn1-mCherry transferred to the vacuolar lumen. MoFpn1 also directly interacted with components of the vesicular sorting complex, including the vacuolar SNARE Vam7 that mediates autophagosome-vacuole fusion. Individual deletion of ATG8 or VAM7 resulted in mislocalization of MoFpn1-mCherry to the vacuolar membrane or MVBs instead of the vacuolar lumen, under autophagy inducing conditions, or remained on the plasma membrane of the mature appressorium. Overall, our study demonstrates that regulation of the intracellular level of iron by Atg8- and Vam7-mediated autophagy-dependent degradation of MoFpn1 is crucial for conidial death and pathogenicity.

Dickeya oryzae causes severe soft rot diseases in a range of important crops. To understand its complicated pathogenic mechanisms, we tried to identify the key virulence regulators through transposon mutagenesis. This led to the identification of a member of the Lrp/AsnC family transcriptional regulators in D. oryzae EC1, designated as Lrp. Phenotype analyses showed that Lrp positively regulated biofilm formation and the production of zeamines, proteases and polygalacturonases, but negatively regulated bacterial swimming motility. Deletion of lrp caused a drastic attenuation in bacterial virulence, indicating that Lrp is a key regulator in the modulation of D. oryzae pathogenicity. We further showed that the transcription of the lrp gene was negatively regulated by the transcriptional regulators SlyA, Fis and OhrR, and the transcriptional expression of tzpA , ohrR and fis was positively modulated by Lrp. Moreover, we demonstrated that Lrp can directly bind to the promoter regions of zmsA , zmsK , prtG , prtX , pehK , pehX , fis , tzpA and ohrR . DNase I footprinting assay determined that Lrp was capable of binding to a specific site (5′‐GTGTAATTATGGGCGTGCTCCGGG‐3′) in the promoter of zmsA . Furthermore, we found that four amino acid residues of Lrp, L20, L23, G111 and T146, are essential to the biological function of Lrp. Overall, this study demonstrated that Lrp is an essential virulence modulator in D. oryzae and suggested that Lrp can be a potent target for controlling the soft rot diseases caused by D. oryzae .