Yinghui Duan

Phospholipids function as dynamic regulators of plant growth and environmental adaptation, extending well beyond their structural roles in biological membranes. This review synthesizes the phospholipid metabolic network and its regulatory functions in plant physiology. We first describe enzymatic reactions and acyl-chain remodeling in phospholipid biosynthesis, and then examine the interaction between phospholipid metabolism and auxin signaling, focusing on phosphatidic acid (PA) and phosphoinositide phosphate (PIP). These lipid molecules regulate the polarization and vesicular trafficking of PIN-FORMED proteins via endocytosis and phosphorylation-dependent mechanisms, thereby controlling auxin distribution during development and stress adaptation. Particular emphasis is placed on PA, a multifunctional signaling lipid that serves as a central molecular hub. PA coordinates hormonal, stress, and circadian signals by engaging and modulating a broad spectrum of protein targets, including kinases, phosphatases, and transcription factors. We also discuss the emerging and evolutionarily conserved functions of phospholipid signaling in cell fate determination, drawing parallels from mammalian cell reprogramming to the regulation of plant cell totipotency and root patterning. Collectively, these findings underscore the critical role of phospholipid-mediated signaling in converting metabolic and environmental cues into developmental reprogramming, providing novel theoretical and functional frameworks for future research in plant lipid biology.

Floral organ development plays a critical role in determining crop yield and quality, yet the molecular mechanisms underlying this process in sesame remain poorly understood. In this study, comparative transcriptomic analyses were conducted between the wild-type Yuzhi11 and a dehiscent-corolla mutant, css1, to investigate the genetic basis of floral organ variation. A total of 114 differentially expressed genes (DEGs) were identified between the two genotypes in both the main and lateral flowers, among which 47 candidate genes were implicated in main/lateral floral organ development. A weighted gene co-expression network analysis (WGCNA) revealed two gene modules significantly associated with the mutant’s main and lateral flowers, respectively. Five hub genes were identified within each module, and their potential regulatory networks and protein–protein interactions networks were characterized. These findings provide new insights into the genetic regulation of flower and fruit development in sesame, and may inform future breeding strategies to optimize floral and yield related traits.

Fusarium oxysporum f. sp. sesami is an extremely destructive pathogen, causing sesame Fusarium wilt disease worldwide. To clarify the pathogenicity and the genetic characters of F. oxysporum f. sp. sesami, we systematically investigated 69 F. oxysporum isolates collected from major sesame-growing areas in China. Among these isolates, 54 isolates were pathogenic and 15 were nonpathogenic according to pathogenicity testing on sesame seedlings. For the pathogenic isolates, three F. oxysporum f. sp. sesami pathogenicity groups were defined based on the three differential sesame hosts for the first time. A translation elongation factor 1α gene tree was constructed to determine the genetic diversity of the F. oxysporum isolates but could not separate F. oxysporum f. sp. sesami isolates from the nonpathogenic isolates and other F. oxysporum formae speciales. Ten secreted-in-xylem (SIX) genes (one family of effectors) were identified in F. oxysporum f. sp. sesami isolates by a search with the genome data, and were subsequently screened in the 69 F. oxysporum isolates. Compared with the SIX gene profiles in other F. oxysporum formae speciales, the presence and sequence variations of the SIX gene homologs directly correlated with the specific pathogenicity of F. oxysporum f. sp. sesami toward sesame. Furthermore, eight of these F. oxysporum f. sp. sesami SIX genes were significantly expressed in sesame plants as infection of the F. oxysporum f. sp. sesami isolate. These findings have important significance for understanding the pathogenic basis of F. oxysporum f. sp. sesami isolates, and will contribute to improve the diagnostics to effectively control Fusarium wilt disease in sesame.

Background: Sesame (Sesamum indicumL., 2n = 2x = 26) is an important oilseed crop with high oil content but small seed size. To reveal the genetic loci of the quantitative seed-related traits, we constructed a high-density single nucleotide polymorphism (SNP) linkage map of an F₂population by using specific length amplified fragment (SLAF) technique and determined the quantitative trait loci (QTLs) of seed-related traits for sesame based on the phenotypes of F₃progeny.Results: The genetic map comprised 2159 SNP markers distributed on 13 linkage groups (LGs) and was 2128.51 cM in length, with an average distance of 0.99 cM between adjacent markers. QTL mapping revealed 19 major-effect QTLs with the phenotypic effect (R²) more than 10%, i.e., eight QTLs for seed coat color, nine QTLs for seed size, and two QTLs for 1000-seed weight (TSW), using composite interval mapping method. Particularly, LG04 and LG11 contained collocated QTL regions for the seed coat color and seed size traits, respectively, based on their close or identical locations. In total, 155 candidate genes for seed coat color, 22 for seed size traits, and 54 for TSW were screened and analyzed.Conclusions: This report presents the first QTL mapping of seed-related traits in sesame using an F₂population. The results reveal the location of specific markers associated with seed-related traits in sesame and provide the basis for further seed quality traits research.

Key message SiDWF1 encodes a gibberellin receptor GID1B-like protein controlling the internode length and plant height in sesame. Abstract Sesame is a high-height crop. Here we systematically analyzed the morphological and genetic characters of the sesame dwarf mutant dw607 (dwf1 type). The plant height and the internode length of dw607 significantly declined, while the thousand seed weight (TSW) significantly increased (P < 0.01). The cell size of stem parenchyma and pith tissue reduced, and vascular bundle cells and parenchyma tissue arranged much tighter in the dwarf mutant. Based on the cross-population association mapping of a RIL population of the cross ‘dw607 (dwf1) × 15N41 (wt type),’ the target interval linked to the short internode length was located on C9.scaffold2 of SiChr.4 in sesame. We further screened the 58 variants using the genomic variant data of 824 germplasm and BSA DNA pools and determined the target gene Sidwf1. The SNP mutation of C₁₀₅₇ to T₁₀₅₇ resulted in the amino acid change of P₁₅₀ (proline) to S₁₅₀ (serine) in SiDWF1. SiDWF1 gene allele is 1,638 bp and encodes a gibberellin receptor GID1B-like protein. Transcription profile assay reflected that Sidwf1 is highly expressed in leaf, stem, bud, and capsule tissues. The dynamic variation in endogenous GA₃ content in dw607 and the wild type was also monitored in this study. The results revealed the molecular genetic mechanism of the internode length and plant height trait in sesame for the first time. The findings supply the theoretical and material basis for developing the marker-assisted selection (MAS) breeding in sesame.

Seed number per capsule (SNC) is a major factor influencing seed yield and is an important trait with complex gene interaction effects. We first performed genetic analysis, gene cloning, and molecular mechanism study for an EMS-induced sesame mutant cs1 with fewer SNC and shorter capsule length (CL). The mutant traits were due to the pleiotropism of a regressive gene (Sics1). Capsule hormone determination showed that five out of 12 hormones, including auxin indole-3-acetic acid (IAA), had significantly different levels between wild type (WT) and mutant type (MT). KEGG pathway analysis showed that plant hormone signal transduction, especially the auxin signal transduction pathway, was the most abundant differentially expressed signaling pathway. After the cross-population association and regional genome screening, we found that three homozygous loci were retained in cs1. Further analysis of these three loci resulted in the identification of SiCRC as the candidate gene for cs1. SiCRC consists of seven exons and six introns encoding 163 amino acids. The SiCRC in cs1 showed a point mutation at intron 5 and exon 6 junction, resulting in the splice site being frame-shifted eight nucleotides further downstream, causing incorrect splicing. Taken together, we assumed the SNP mutation in SiCRC disrupted the function of the transcription factor, which might act downstream of the CRC-auxin signal transduction pathway, resulting in a shorter CL and less SNC mutation of cs1 in sesame. Our results highlight the molecular framework underlying the transcription factor CRC-mediated role of auxin transduction in SNC and CL development.

Leaf shape can affect plantlet development and seed yield in sesame. The morphological, histological and genetic analyses of a sesame mutant cl1 (cl) with curly leaf and indehiscent capsule traits were performed in this study. In order to clone the cl1 gene for breeding selection, genome re-sequencing of the 130 individuals of cl1 × USA (0)-26 F2 population and a bulked segregation analysis (BSA) pool was carried out. The genome re-sequencing data of the 822 germplasm with normal leaf shape were applied. For cl1 mutant, the adaxial/abaxial character of the parenchyma cells in the leaf blades is reduced. Results proved that the leaf curling trait is controlled by a recessive gene (Sicl1). Cross- population association of the F2 population of cl1 × USA (0)-26 indicated that the target cl locus was located on the interval C29 between C29_6522236 and C29_6918901 of SiChr. 1. Further regional genome variants screening determined the 6 candidate variants using genomic variants data of 822 natural germplasm and a BSA pool data. Of which, 5 markers C29_6717525, C29_6721553, C29_6721558, C29_6721563, and C29_6721565 existed in the same gene (C29.460). With the aid of the validation in the test F2 population of cl1 × Yuzhi 11 and natural germplasm, the integrated marker SiCLInDel1 (C29: 6721553–6721572) was determined as the target marker, and C29.460 was the target gene SiCL1 in sesame. SiCL1 is a KAN1 homolog with the full length of 6835 bp. In cl1, the 20 nucleic acids (CAGGTAGCTATGTATATGCA) of SiCLInDel1 marker were mutagenized into 6 nucleic acids (TCTTTG). The deletion led to a frameshift mutation and resulted in the earlier translation termination of the CL gene. The Sicl1 allele was shortened to 1829 bp. SiCL1 gene was expressed mainly in the tissues of stem, leaf, bud, capsule and seed. SiCL1 encodes a transcription repressor KAN1 protein and controls leaf curling and capsule indehiscence in sesame. The findings provided an example of high-efficient gene cloning in sesame. The SiCL1 gene and the cl1 mutant supply the opportunity to explore the development regulation of leaf and capsule, and would improve the new variety breeding with high harvest mechanization adaption in sesame.