Azza M. Elgendy

Melatonin is a conserved indolamine implicated in circadian and developmental timing, but its role in social-insect task allocation is unclear. Here, we show that melatonergic signaling modulates the nurse → forager transition in the honey bee (Apis mellifera). A single hemocoelic dose of melatonin (100 ng) markedly reduced hive retention and advanced the age at first waggle dance by ≈9 days (median 11.8 vs. 20.9 days; common-language effect size = 0.94). Complementary manipulations—pharmacological antagonism with luzindole and RNA interference (RNAi)-mediated knockdown of a candidate melatonin receptor (AmMTR/AmMT2; transcript reduction ≈65–79% at 24–72 h)—produced reciprocal suppression of foraging, indicating pathway dependence. Transcriptional profiling revealed a forager-age peak in the arylalkylamine N-acetyltransferase ortholog AmNAT2 (≈10-fold increase near day 23), while AmNAT1 remained unchanged; melatonin treatment was associated with a trend toward increased Amα-glucosidase expression. Computational analyses classify AmMTR as a class-A GPCR and identify plausible melatonin-compatible pockets; promoter scans reveal high-confidence circadian motif matches upstream of AmMTR. These in silico results are presented as hypothesis-generating. Together, the behavioral, molecular, pharmacological and computational lines of evidence support melatonin as a circadian-informed modulatory signal that helps align neuroendocrine and metabolic states with the timing of extranidal behavior. Confirmation via receptor functional assays and broader colony replication will be important.

Gene editing technologies have evolved remarkably from zinc-finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) to the highly efficient clustered regularly interspaced short palindromic repeats and CRISPR-associated (CRISPR-Cas) systems. The development of the CRISPR-Cas system to be simple, precision, and versatile tools have revolutionized modern molecular biology and therapeutic research. This review summarizes the recent advances in CRISPR-based applications, including gene function studies, diagnostics, ex vivo and in vivo therapies, antimicrobial resistance control, and parasite genome manipulation. The paper also highlights the major technological challenges related to editing specificity, delivery systems, and off-target effects, together with recent innovations such as base editing, prime editing, and CRISPR-mediated transcriptional modulation. Some challenges facing the CRISPR- Cas system applications haven summarized in brief. Furthermore, the integration of artificial intelligence has emerged as a promising tool to enhance prediction accuracy and therapeutic efficiency. Overall, this review outlines the current progress, biomedical applications, and future perspectives of CRISPR-Cas technologies in precision medicine and biotechnology.

Vitellogenins (Vgs) are yolk protein precursors that are regulated by juvenile hormone (JH) and/or 20-hydroxyecdysone (20E) in insects. JH acts as the principal gonadotropin that stimulates vitellogenesis in hemimetabolous insects. In this study, we cloned and characterized the Periplaneta americana Vitellogenin 2 (Vg2) promoter. Multiple sites for putative transcription factor binding were predicted for the 1,804 bp Vg2 promoter region, such as the Broad-Complex, ecdysone response element (EcRE), GATA, Hairy, JH response element (JHRE), and Methoprene (Met)-binding motif, among others. Luciferase reporter assay has identified that construct −177 bp is enough to support JH III induction but not 20E suppression. This 38 bp region (from −177 to −139 bp) contains two conserved response element half-sites separated by 2 nucleotides spacer (DR2) and is designated as Vg2RE (⁻¹⁶⁸GAGTCACGGAGTCGCCGCTG⁻¹⁴⁹). Mutation assay and luciferase assay data using mutated constructs verified the crucial role of G residues in Vg2RE for binding the isolated fat body nuclear protein. In Sf9 cells, a luciferase reporter placed under the control of a minimal promoter containing Vg2RE was induced by JH III in a dose- and time-dependent manner. Nuclear proteins isolated from previtellogenic female fat body cells bound to Vg2RE, and this binding was outcompeted by a 50-fold excess of cold Drosophila melanogaster DR4 and Galleria mellonella JH binding protein response elements (Chorion factor-I/Ultraspiracle). Affinity pull-down experiment with nuclear extracts of previtellogenic female fat body, using 31-bp probe Vg2RE as bait, yielded a 71 kDa candidate nuclear protein that may mediate the regulatory action of the JH III.

Avian malaria is a mosquito-borne disease caused by Plasmodium spp. protozoa. Although these parasites have been extensively studied in North America and Eurasia, knowledge on the diversity of Plasmodium, its vectors and avian hosts in Africa is scarce. In this study, we report on natural malarial infections in free-ranging sparrows (Passer domesticus) sampled at Giza Governorate, Egypt. Parasites were morphologically characterized as Plasmodium cathemerium based on the examination of thin blood smears from the avian host. Sequencing a fragment of the mitochondrial cytochrome b gene showed that the parasite corresponded to lineage PADOM02. Phylogenetic analysis showed that this parasite is closely related to the lineages SERAU01 and PADOM09, both of which are attributed to P. cathemerium. Experimental infection of Culex pipiens complex was successful, with ookinetes first detected at 1-day post infection (dpi), oocysts at 4 dpi and sporozoites at 6 dpi. The massive infection of the salivary glands by sporozoites corroborates that Cx. pipiens complex is a competent vector of PADOM02. Our findings confirm that Plasmodium lineage PADOM02 infects sparrows in urban areas along the Nile River, Egypt, and corroborate that Cx. pipiens complex is a highly competent vector for these parasites. Furthermore, our results demonstrate that this lineage corresponds to the morphospecies P. cathemerium and not P. relictum as previously believed.

Although the regulation of vitellogenesis in insects has been mainly discussed in terms of ‘classical’ lipid hormones, juvenile hormone (JH), and 20-hydroxyecdysone (20E), recent data support the notion that this process must be adjusted in harmony with a nutritional input/reservoir and involvement of certain indoleamines and neuropeptides in regulation of such process. This study focuses on crosstalks among these axes, lipid hormones, monoamines, and neuropeptides in regulation of vitellogenesis in the American cockroach Periplaneta americana with novel aspects in the roles of arylalkylamine N-acetyltransferase (aaNAT), a key enzyme in indoleamine metabolism, and the enteroendocrine peptides; crustacean cardioactive peptide (CCAP) and short neuropeptide F (sNPF). Double-stranded RNA against aaNAT (dsRNA^aaNAT) was injected into designated-aged females and the effects were monitored including the expressions of aaNAT itself, vitellogenin 1 and 2 (Vg1 and Vg2) and the vitellogenin receptor (VgR) mRNAs, oocyte maturation and changes in the hemolymph peptide concentrations. Effects of peptides application and 20E were also investigated. Injection of dsRNA^aaNAT strongly suppressed oocyte maturation, transcription of Vg1, Vg2, VgR, and genes encoding JH acid- and farnesoate O-methyltransferases (JHAMT and FAMeT, respectively) acting in the JH biosynthetic pathway. However, it did not affect hemolymph concentrations of CCAP and sNPF. Injection of CCAP stimulated, while sNPF suppressed oocyte maturation and Vgs/VgR transcription, i.e., acting as allatomedins. Injection of CCAP promoted, while sNPF repressed ecdysteroid (20E) synthesis, particularly at the second step of Vg uptake. 20E also affected the JH biosynthetic pathway and Vg/VgR synthesis. The results revealed that on the course of vitellogenesis, JH- and 20E-mediated regulation occurs downstream to indoleamines- and peptides-mediated regulations. Intricate mutual interactions of these regulatory routes must orchestrate reproduction in this species at the highest potency.

The northern exposure sign has been described as a high specificity sign in sigmoid volvulus. On a supine abdominal radiograph, the apex of the sigmoid volvulus is seen above (cranial to) the transverse colon.