Feng Zhang

The cyst nematode pathogens can cause a yield loss of 30-50% via stunting root growth on grains (Bonfil et al. 2004). Heterodera avenae, H. filipjevi, and H. latipons are identified as the most economically influential and harmful species on wheat (Toumi et al. 2016). H. filipjevi was first detected in Henan Province in 2010, and had subsequently spread to many provinces (Peng et al. 2010; Peng et al. 2016; Cui et al. 2021). In May 2022, wheat plants showing yellowing and premature senescence were observed in different wheat planting areas throughout Shaanxi Province. Nine soil samples were collected from Pucheng County (34°94'32"N, 109°57'23"E) of Shaanxi Province. Among them, six soil samples were detected to have cysts via the sieving-decanting method with an average cyst population density of 10.6 cysts per 100 cubic centimeters of soil. The cysts and second-stage juveniles (J2s) were identified based on both morphological and molecular identification. Morphologically, the cysts are lemon shaped, with a protruding vulval cone. The shell surface had a Z-shaped pattern and covered with a white subgrain layer. The cone of the vulva is bifenestrate in horseshoe-shape. Underbridge exists and is well-developed. The measurements of the cysts (n=16) as follows: body length 670.24 ± 60.67 (593.43 to 778.42) μm; body width 479.03 ± 54.51 (355.91 to 567.52) μm; length/width ratio 1.41 ± 0.16 (1.20 to 1.72); fenestra length 52.30 ± 4.32 (46.82 to 59.13) μm; fenestra width 27.59 ± 3.39 (22.42 to 34.91) μm; vulval slit length 9.17 ± 0.47 (8.69 to 10.37) μm. J2s measurements (n=15) as follow: body length 522.46 ± 24.18 (482.54 to 572.23) μm; body width 26.47 ± 3.08 (22.21 to 30.16) μm; stylet length 23.42 ± 3.24 (16.48 to 29.11) μm. These morphological characteristics and morphometrics are consistent with those of H. filipjevi (Peng et al. 2010). The DNA of single cyst was extracted with four replicates (Shao et al. 2022). The COI fragment sequence was amplified with the specific primers (HfF9/HafR8) according to Niu's research (Niu et al. 2016). The identities of amplification fragments (Genbank PQ650771, PQ650772 and PQ650773) are 98.77%, 99.08% and 98.77% matching the published sequences of H. filipjevi (MG523031.1 and MK093059.1), respectively. We also used the RAPD species-specific primers of H. filipjevi (HfF1/HfR1) to acquire 647bp sequences (Genbank PV165784, PV165785 and PV165786) which have 99.54%, 99.38% and 99.38%identities with published H. filipjevi sequence (KC529338.1) (Peng et al. 2013). Pathogenicity was confirmed by infecting wheat (Triticum aestivum 'Weilong 169'). The eggs of the cyst nematode population hatched at 15℃, and the emerged J2s were used for potted wheat inoculating in greenhouse under 18-24℃. Nine plants in three pots were inoculated and three plants in one pot remained served as the uninoculated control, the inoculum was 800 J2s per pot. After three months, an average of 15.7 cysts were detected from each of the inoculated plants, and the cysts were identified as H. filipjevi via molecular characteristics. To our knowledge, this is the first report of H. filipjevi in shaanxi. As Shaanxi is an important part of the Huang-Huai-Hai wheat region in China, where its occurrence should be attached great importance.

Root-knot nematodes (Meloidogyne spp.) are plant-parasitic nematodes that cause serious damage worldwide. There are many species of traditional Chinese medicine (TCM) plants, but only a few have been reported to be infected by Meloidogyne species. From 2020 to 2022, a survey was conducted in the Qinling mountain area, which is the main production region of TCM plants in China. Obvious galling symptoms were observed on the root systems of 15 species of TCM plants. Females were collected from diverse diseased TCM plants and subsequently identified at morphological and molecular levels. Among the 20 diseased root samples collected, Meloidogyne hapla populations were identified in 12 samples (60%), and M. incognita populations were identified in eight samples (40%). Among the 15 species of diseased TCM plants, eight species, namely, Scutellaria baicalensis, Leonurus japonicus, Dioscorea zingiberensis, Cornus officinalis, Viola philippica, Achyranthes bidentata, Senecio scandens, and Plantago depressa, were reported to be infected by Meloidogyne species for the first time. The host status of five species of TCM plants for two M. hapla isolates and one M. incognita isolate from TCM plants in this study was then evaluated. Differences in TCM plants’ response to nematode infection were apparent when susceptibility was evaluated by the egg counts per gram of fresh root and the reproduction factor of the nematodes. Among the five species of TCM plants tested, Salvia miltiorrhiza and Gynostemma pentaphyllum were the most susceptible, while S. baicalensis and V. philippica were not considered suitable hosts for M. hapla or M. incognita.

Daylilies (Hemerocallis citrina Baroni) are herbaceous perennials grown extensively as ornamental plants worldwide. In China, daylilies are important cash crops, which are used for their roots, lea...

Gynostemma pentaphyllum, belonging to Cucurbitaceae, is a herbaceous climbing plant with multiple medicinal values (Li et al., 2019). It has been planted in Pingli County (109.35 E, 32.39 N), Ankang, Shaanxi province, China for a long history with more than 3000 ha per year. In April 2021, typical root-knot nematode disease symptoms, stunting and galled roots with massive egg masses, were observed on local G. pentaphyllum plants in several gardens. Meloidogyne females and egg masses were dissected from the infected roots. The female was spherical in body shape with a project neck; the excretory pore was at level of or posterior to stylet knobs, 10-20 annules behind head; the perineal pattern had a high dorsal arch, sometimes square or trapezoidal in shape, without obvious lateral lines. The male head was not offset with body, head cap was of stepped outline and concaved at center of top end in lateral view; stylet knobs were prominent, usually demarcated from shaft. Morphological measurements of females (n=20) were: body length (L)= 851.78 ± 83.55 µm (700.15 µm to 986.48 µm); maximum body width (W)= 633.11 ± 71.69 µm (453.09 µm to 746.31 µm); stylet length (ST)= 14.81 ± 0.69 µm (13.31 µm to 15.76 µm); stylet knob height (STKH)= 1.54 ± 0.09 µm (1.45 µm to 1.81 µm); stylet knob width (STKW)= 3.61 ± 0.11 µm (3.38 µm to 3.87 µm); and distance from dorsal esophageal gland opening to the stylet (DGO)= 3.56 ± 0.13 µm (3.28 µm to 4.90 µm). Measurements of males (n=20) were: L=1756.96 ± 67.81 µm (1643.58 µm to 1862.14 µm); W=55.37 ± 1.28 µm (53.46 µm to 57.66 µm); ST= 22.75 ± 1.05µm (19.14 µm to 24.88 µm); STKH= 2.59 ± 0.14 µm (2.45 µm to 2.72 µm); STKW= 3.66 ± 0.13 µm (3.27 µm to 3.91 µm); and DGO= 3.52 ± 0.18 µm (3.38 µm to 4.72 µm). Measurements of second-stage juveniles (J2) (n=20) were: L= 418.99 ± 22.04 µm (376.89 µm to 450.66 µm); W= 14.77 ± 1.15 µm (13.03 µm to 17.77 µm); ST= 12.84 ± 0.45µm (12.05 µm to 13.75 µm); STKH= 1.44 ± 0.13 µm (1.14 µm to 1.71 µm); STKW= 2.25 ± 0.23 µm (1.81 µm to 2.76 µm); and DGO= 1.81 ± 0.31 µm (0.38 µm to 2.56 µm). The morphological characteristics of this nematode were consistent with Meloidogyne incognita (Kofoid and White, 1919) Chitwood, 1949 (Williams, 1973; Eisenback and Hirschmann, 1981). Identification was further confirmed with DNA extracted from 20 individual females. Part of the rDNA spanning internal transcribed spacer (ITS) 1, 5.8S gene, and ITS2 was amplified with the pair of primers: rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). A 768 bp fragment (GenBank Accession No. MZ613806) was obtained, showing 100% identical (768 bp to 768 bp) to the known sequences of M. incognita (GenBank Accession Nos. MH113856, KC464469, and MT921010). Species identification was also confirmed by amplifying part of the NADH dehydrogenase subunit 5 (nad5) from mitochondrial DNA with primers: NAD5-F/R (TATTTTTTGTTTGAGATATATTAG/CGTGAATCTTGATTTTCCATTTTT) (Janssen et al., 2016). The resulting 611 bp fragment was deposited in GenBank with Accession No. MZ613807. The fragment showed a highest identity of 99.67% (601 bp out of 611 bp) with sequences from other M. incognita isolates (GenBank Accession Nos. MW759707, MW759706, MW759705). Based on both morphological and molecular data, the root-knot nematode from G. pentaphyllum was identified as M. incognita. A pathogenicity test was carried out by inoculating 1500 J2 hatched from the egg masses dissected from the diseased roots to a 4-weeks-old healthy G. pentaphyllum seedling cultured in sterilized sandy soil in pot, 15 plants were inoculated and 5 non-inoculated plants served as controls. After maintained at 25°C for 6 weeks, all of the inoculated plant roots showed galling symptoms which were similar to those observed in the field. Nematodes were collected from root and soil, and an average reproduction factor value of 3.51 was obtained. While no galls were observed on the control plants. For further confirmation, all egg masses dissected from inoculated plants were identified to be M. incognita with its sequence specific primers Mi-F/Mi-R (GGGCAAGTAAGGATGCTCTGAC/CTTTCATAGCCACGTCGCGATC) (Ray et al., 1994). In this study, G. pentaphyllum has been identified as a new host of M. incognita, hence the occurrence status and control of root-knot disease on G. pentaphyllum caused by this pathogen would be new problems in production and need further study.

Tomato (Solanum lycopersicum) is an important vegetable crop in Hainan province, Southern China. In this area, rice and tomato rotation is the most common way for tomato cultivation. During March o...

Background Egg hatching in Meloidogyne incognita is a highly regulated developmental event and is strictly correlated with temperature. It has been demonstrated that exposure of M. incognita eggs to low temperature seriously affects their embryonic development. On the other hand, clear evidence has shown that M. incognita is able to overwinter at subzero soil temperatures in certain open fields. Therefore, subtle physiological and genetic adaptations may occur in M. incognita to minimize freezing injuries. Objective A growing body of evidence indicates that cold acclimation plays a large role in an individual organism’s ability to cope with freezing-induced cellular damage. Given the decreasing temperatures in late autumn or early winter, we hypothesize that natural cold acclimation occurring during these periods may assist M. incognita in overwintering. Methods Transcriptomic analysis and functional enrichment analyses were used to identify and annotate differentially expressed genes (DEGs) in acclimated eggs. The expression of DEGs involved in signal transduction and protein assembly was subsequently validated by reverse transcription quantitative PCR (RT-qPCR). Results Relatively long-term preacclimation at 4 °C significantly accelerated the hatching of M. incognita eggs that were subjected to freezing at − 1 °C. Using a transcriptomic approach, we further identified 686 and 460 up- and downregulated transcripts, respectively, in pre-cold-acclimated eggs. Additionally, we used Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway and Gene Ontology annotations for functional enrichment analyses of the differentially expressed genes (DEGs). Conclusion The phenomenon in which M. incognita safely overwinters at subzero soil temperatures in certain areas may be attributed to the natural cold acclimation occurring in late autumn. Here, the identification of DEGs between acclimated and nonacclimated eggs will provide us with promising directions for future studies on the mechanisms of M. incognita freezing tolerance.