María del Carmen Córdoba-Sellés

In two successive winters (2009 and 2010), 14 hot pepper (Capsicum annuum) samples showing unusual symptoms were surveyed in permanently irrigated seasonal vegetable gardens along the Blue Nile in central Sudan (specifically in Gezira State). Symptoms included leaf curling, leaf deformation, reduced leaf size, leaf puckering, interveinal yellowing, vein clearing, or yellow patches. Total RNA was extracted from symptomatic leaves and analyzed by reverse transcription (RT)-PCR with degenerate primer pairs that amplify different viral species within the family Luteoviridae (1). Amplification of a 340-bp fragment of the coat protein gene (CP) was obtained in all the collected samples analyzed. The amplified fragments were purified and sequenced (Accession Nos. KC685313 to 26), showing 99, 97, and 95 to 99% nucleotide identities to Pepper yellows virus (PYV, accession no. FN600344 from Turkey), Pepper vein yellows virus (PeVYV, AB594828 from Japan) and Pepper yellow leaf curl virus (PYLCV, HM439608 from Israel), respectively. These three viruses belong to the genus Polerovirus and are considered synonyms of the same virus species PeVYV described with those names in different countries (3). Two samples were also tested by RT-PCR with the general Polerovirus primer pair Pol-G-F and Pol-G-R, which amplified a 1.1-kb product spanning the 3′ half of the RNA-dependent RNA polymerase (RdRp) to the 5′ half of CP and movement protein (2). The amplified fragments (KC692834 and KC692833) showed 97, 96, and 95% nt identity with PYV (FN600344), PeVYV (JX427533), and PYLCV (HM439608), respectively. The presence of the recently described Polerovirus PeVYV is the first report of detection in pepper in Sudan. PeVYV has recently been identified in seven other countries (India, Indonesia, Mali, the Philippines, Spain, Taiwan, and Thailand) and on one new host, Solanum nigrum, which suggests this new Polerovirus species poses a potentially wide geographical distribution and a global threat for pepper crops (3,4). References: (1) A. D. Abraham et al. Afr. J. Biotechnol. 7:414, 2008. (2) D. Knierim et al. Plant Pathol. 59:991, 2010. (3) D. Knierim et al. Arch. Virol. 158:1337, 2013. (4) F. Villanueva et al. Plant Dis. 97:1261, 2013.

Tobacco false broomrape disease is a serious problem in tropical countries. To identify its cause, experiments were conducted in tobacco fields. Six actinomycete strains were isolated from white succulent outgrowths of tobacco roots and their pathogenicity was confirmed by biological testing. Based on phenotypic and 16S rRNA gene sequence BLAST analysis, the strains were identified as members of the genus Nocardia. This association was also confirmed by secA1 gene phylogenetic analysis. This is the first report of Nocardia sp. as the cause of tobacco false broomrape.

In 2009, Pittosporum tobira (Thunb.) Ait. plants showing virus-like symptoms were observed in two ornamental greenhouses in two regions of the eastern coast of Spain (Tarragona and Valencia). Affected plants showed veinal yellowing and interveinal yellow mottling on the leaves. In addition, surveys conducted in 2010 in three public gardens in Valencia revealed 4% of P. tobira plants grown as hedges showed similar, but less severe symptoms. Five symptomatic and five asymptomatic P. tobira leaves were collected and analyzed by double antibody sandwich-ELISA using polyclonal antisera for Alfalfa mosaic virus (AMV) (SEDIAG S.A.S., Longvic, France) and Eggplant mottled dwarf virus (EMDV) (Deutsche Sammlung von Mikroorganismen und Zellkulturen Gmbh [DSMZ], Braunschweig, Germany). Samples were considered positive only if the mean absorbance value of duplicate wells was more than three times the mean absorbance of healthy control leaf samples. Only the five symptomatic samples tested positive for EMDV in the serological analyses. To confirm the results, a pair of EMDV-specific primers was designed using the published sequence of a fragment of the EMDV polymerase gene available in GenBank (Accession No. AM922322): EMDV-D (5′ TATGCGAGAATTGGGAGTGGGTAGT 3′) and EMDV-R (5′ CATTGTTATCCCGGGAAGTATTT 3′) targeting a 400-bp fragment. Total RNA was extracted from the symptomatic leaves and tested by reverse transcription (RT)-PCR assay with specific primers for AMV (4) and the primer pair designed for EMDV. The type isolate (EMDV-PV-0031, DSMZ) was used as a positive control sample in the serological and molecular analyses. None of the samples tested positive for AMV. The same five symptomatic samples that tested positive in the serological assays also tested positive for EMDV in the RT-PCR assay. Two RT-PCR products amplified from RNA of symptomatic P. tobira leaves and one from the type isolate were purified and directly sequenced. BLAST analyses of two sequences from infected P. tobira leaves (Accession Nos. HM636918 and HM636919) revealed 90% nucleotide identity to both the EMDV-Egg isolate (Accession No. AM922322) and the type isolate (EMDV-PV-0031, DSMZ), and 98% similarity among the P. tobira isolates. EMDV was first reported in the Canary Islands, Spain (3), and later was detected in the northeastern peninsular Spain on cucumber and eggplant (1). Although EMDV has been described as affecting P. tobira in countries such as Italy, Libya, and the former Yugoslavia (3), to our knowledge, this is the first report of EMDV infecting P. tobira in Spain. EMDV is generally considered of minor importance. However, P. tobira infection might have epidemiological consequences for susceptible cultivated crops such as eggplant or cucumber. Moreover, where P. tobira is used as a vegetatively propagated ornamental plant, EMDV could be transmitted from infected plants by the leafhopper vector (2). References: (1) J. Aramburu et al. Plant Pathol. 55:565, 2006. (2) G. H. Babaie and K. Izadpanah. J. Phytopathol. 151:679, 2003. (3) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Version: 20. Retrieved from http://biology.anu.edu.au/Groups/MES/vide/ , August, 1996. (4) L. Martínez-Priego et al. Plant Dis. 88:908, 2004.

In 2008 and 2009, symptoms of curling, yellow and purple discoloration of leaves, stunting of shoots and tap roots, and formation of bunchy, fibrous secondary roots were observed in commercial carrot (Daucus carota L.) fields located in several production areas of Spain (Alicante, Albacete, Segovia, and Valladolid). Incidence of this disease was almost 100% in individual affected fields. Similar symptoms were reported from 1997 to 1998 in various carrot production areas of Spain (the Canary Islands, Segovia, and Madrid) and were associated with infection of stolbur and aster yellows phytoplasmas (2). Moreover, the observed symptoms resembled those caused by Spiroplasma citri in carrots affected by the carrot purple leaf disease recently reported in the United States (4). Studies were conducted to investigate whether S. citri and phytoplasmas were associated with the observed carrot symptoms. Total DNA was extracted from 0.5 g of phloem tissue of 13 symptomatic and 3 asymptomatic plants with DNeasy Plant Mini Kit (Qiagen, Valencia, CA). DNA samples were analyzed by nested-PCR assays using primers pair P1/P7 (1) and R16F2n/R16R2n (3) for phytoplasmas and ScR16F1/ScR16R1 followed by ScR16F1A/ScR16R2 (4) for S. citri detection. DNA of a known strain of S. citri (Sediag, Longvic, France) was used as a positive control of the assay. Analyses revealed that 8 of the 13 symptomatic plants tested positive for S. citri; the plants were collected from three different provinces of Spain, namely, Alicante, Valladolid, and Segovia. Two symptomatic plants were double infected by S. citri and a phytoplasma strain belonging to the Aster yellows group (16SrI), subgroup 16SrI-A. However, none of the symptomatic plants presented single infection with phytoplasmas. S. citri identity was determined by sequencing two nested PCR products (1.1 kb) that yielded identical sequences deposited in the GenBank database (Accession Nos. HM124555 and HM124556). BLAST analysis showed 100% nt identity with a sequence of S. citri from carrot (Accession No. DQ112019) associated with the new carrot disease referred to as ‘carrot purple leaf reported in Washington State (4). To our knowledge, this is the first report of S. citri associated with carrot in Europe. References: (1) S. Deng and C. Hiruki. J. Microbiol. Methods 14:53, 1991. (2) M. I. Font et al. Bol. San. Veg. Plagas 25:415, 1999. (3) I. M. Lee et al. Int. J. Syst. Bacteriol. 48:1153, 1998. (4) I. M. Lee et al. Plant Dis. 90:989, 2006.

In surveys to determine the occurrence and distribution of the ‘torrado’ disease (Tomato torrado virus, ToTV) in the main Spanish tomato growing areas from 2001 to 2008, a total of 584 samples from symptomatic and asymptomatic plants were collected from 92 greenhouses. The tests showed that 451 plants from 85 greenhouses of different areas were infected with ToTV. The majority of the positive samples showed typical symptoms of the disease. However, plants showing different symptoms of necrosis and even asymptomatic plants were infected with the virus. Co‐infection of ToTV with Pepino mosaic virus (PepMV) occurred in a large number of samples (60.5%), and several samples were infected with other tomato‐infecting viruses, including Cucumber mosaic virus (CMV), Potato virus Y (PVY), Tomato spotted wilt virus (TSWV), Tomato mosaic virus (ToMV), Parietaria mottle virus (PMoV), Tomato chlorosis virus (ToCV) and Tomato yellow leaf curl virus (TYLCV). Tomato apex necrosis virus (ToANV) was not detected in any of those samples with similar symptoms to those described for that virus. Additional tests revealed that (i) ToTV whitefly transmission is highly efficient and variety‐dependent in tomato plants, (ii) Datura stramonium is another solanaceous species susceptible to this virus and (iii) the tissue‐printing hybridization is a reliable technique which could facilitate the routine diagnosis and large‐scale analysis of ToTV.

The population structure and genetic variation of Tomato torrado virus (ToTV) were estimated from 19 Spanish isolates collected from 2001 to 2009 in different tomato‐production areas by analyses of the partial nucleotide sequences of five regions of the virus genome: the protease cofactor (Pro‐Co) and the RNA‐dependent RNA polymerase (RdRp) in RNA1, and the movement protein (MP) and two subunits of the coat protein (CP; viz. Vp35 and Vp23) in RNA2. Three Hungarian isolates of the virus were also included in the analyses. All the ToTV isolates clustered together in the phylogenetic analysis of the nucleotide sequences of the different regions. However, some genetic diversity was observed in the case of the two CP subunits among the Gran Canaria isolates and the remaining ToTV‐isolates analysed, which grouped together. A high similarity was observed among all the isolates and the two published ToTV isolates: the ToTV type isolate (PRI‐ToTV0301) and the Polish isolate Wal03. The most variable encoding regions studied were those on RNA2. In general, no correlation was found between genetic diversity and collection date. Studying the genetic distances between pairs of sequences, the ratio between nonsynonymous (amino‐acid‐replacing) and synonymous (silent mutational) substitutions was low, indicating a strong negative selective pressure in the studied regions. Nine negatively selected sites (distributed in Pro‐Co, MP, Vp23 and Vp35) and just one positively selected one (in Pro‐Co) were found for all the genome regions studied.

Optical and electron microscopy studies were carried out to investigate the cytopathology induced in tomato leaves infected by Tomato torrado virus (ToTV), a new picorna‐like virus associated with the ‘Torrado’ disease. Infected leaves, showing typical Torrado disease symptoms were surveyed in commercial greenhouses in the main tomato production areas of Spain. The effect of the co‐infection of ToTV with other viruses which commonly infect tomato crops was also studied. Ultra‐thin sections of ToTV‐infected tomato leaves did not show a strong cellular alteration. However, crystalline arrays of isometric virus‐like particles (VLPs) of 20–30 nm in the inclusion bodies were observed in phloem parenchyma cells of the infected tissues. Tissues co‐infected by ToTV and either Tomato chlorosis virus (ToCV) or Pepino mosaic virus (PepMV) presented more severe cellular alterations. The most deleterious consequences for tomato cells were found in triple infections of ToTV, PepMV and Tomato spotted wilt virus (TSWV), where characteristic cell wall overgrowth was distinguishable, together with a large amount of necrotic cells.