Qing Chang

Ditylenchus destructor, commonly known as the potato rot nematode, is a significant plant-parasitic pathogen affecting over 120 plant species globally. Effective control measures for D. destructor are limited, underscoring the need a high-quality reference genome to understand its pathogenic mechanisms. Herein, we combined Illumina short reads, PacBio long reads, and Hi-C mapping technology to construct a chromosome-scale reference genome assembly for D. destructor. The genome assembly totals 133.86 Mb, with 129.51 Mb (96.74%) of sequences anchored onto 4 pseudo-chromosomes, achieving a scaffold N50 of 32.25 Mb. The assembled genome contains 28.14% repeat sequences and identifies 19,165 protein-coding genes, of which 18,444 (96.24%) are functionally annotated. The genome assembly demonstrates a high level of completeness, with 73.8% complete the nematoda-specifc Benchmarking Universal Single-Copy Orthologs (BUSCO) genes, significantly higher than that of other reported plant-parasitic nematode genomes. This high-quality reference genome will serve as a valuable genomic resource for future research aimed at understanding the pathogenesis of D. destructor and developing effective control strategies.

Siegesbeckia orientalis L., belonging to the family of Asteraceae and also known as ‘Xi-Xian Cao’ or Herba Siegesbeckiae, has been an important traditional Chinese medicine since the Tang Dynasty (...

Ditylenchus destructor and D. dipsaci are important nematodes that have a significant economic impact on agronomic and horticultural plants worldwide. Microscopic observation alone may not distinguish between D. destructor and D. dipsaci. Accurate and rapid identification of these two species is essential for effective pest management. In the present study, a species-specific PCR assay was developed to detect and differentiate D. destructor and D. dipsaci based on the rDNA-ITS sequences. The primers developed in this study can specifically amplify fragments of DNA from D. destructor and D. dipsaci in the target population, without amplifying DNA from other non-target nematodes within the genus Ditylenchus. The sensitivity test revealed that this procedure has the ability to detect single second-stage juveniles (J2) of D. dipsaci at a dilution of 1/128 and D. destructor at a dilution of 1/64. Additionally, it can detect genomic DNA (gDNA) at concentrations of 10 pg/µL for D. dipsaci and 1 ng/µL for D. destructor. These results align with previously reported results obtained through RPA and LAMP methods. Furthermore, the primers developed in this study for D. destructor not only were able to amplify six different haplotypes of nematodes but also successfully detected it in infested plant roots and soil samples, thereby shortening the time and reducing the number of steps required for detection. Thus, this assay, which does not necessitate taxonomic or morphological expertise, significantly enhances the diagnosis of D. destructor and D. dipsaci in infested fields. This advancement aids in the early control of these nematodes.

Meloidogyne incognita can severely infect and harm some crops in temperate zones under open field in some cases, even though it’s more widespread and economically important in tropical and subtropical regions (Eisenback, 2020). In early June 2022, patches with poor growth maize plants were observed in Dali County (109.93E, 34.80N) of Shaanxi province, China. The infected maize plants were stunted with galled and small roots. Females, males, second-stage juveniles (J2s) and egg masses were extracted and collected from galled roots and soil for morphological identification. The perineal pattern of females had a dorsally high square arch lacking obvious lateral lines. Stylet knobs of females were rounded and set off. The excretory pores were at level of or posterior to stylet knobs, 10-20 annules behind head. The head cap of males was flat to centrally concave, the stylet shaft constricted slightly at the junction with the knobs, and stylet knobs were broadly elongate to round, set off, flat and the width usually greater than the height. Measurements of females (n=20) were: body length (L)= 734.63 ± 79.24 µm (642.15 µm to 788.48 µm); maximum body width (W)= 487.14 ± 50.79 µm (426.09 µm to 556.42 µm); stylet length (ST)= 14.78 ± 1.57 µm (13.17 µm to 16.56 µm); and distance from dorsal esophageal gland opening to the stylet knobs (DGO)= 3.55 ± 0.13 µm (3.17 µm to 3.90 µm). Measurements of males (n=10) were: L=1483.76 ± 134.81 µm (1174.39 µm to 1635.62 µm); W=44.37 ± 3.28 µm (39.76 µm to 50.26 µm); ST= 19.76 ± 1.05 µm (17.84 µm to 22.36 µm); and DGO= 3.48 ± 0.28 µm (3.08 µm to 3.87 µm). The morphological characteristics of this nematode were consistent with Meloidogyne incognita (Kofoid and White, 1919) Chitwood, 1949 (Williams, 1973; Eisenback and Hirschmann, 1981). Moreover, the identification was further confirmed by PCR using two pairs of primers, D2A/D3B and NAD5F/R, with DNA extracted from 20 individual females, respectively (Subbotin et al., 2006; Janssen et al., 2016). Both the D2-D3 region sequence (MZ665547) amplified by D2A/D3B and the 597 bp sequence (MZ665548) amplified by NAD5F/R showed >99% identity with sequences of other M. incognita isolates. Both morphological and molecular data identified the root-knot nematodes on maize as M. incognita. Then ten maize seedlings maintained in pots containing autoclaved sandy soil at 25°C were each inoculated with 2000 freshly hatched J2s of the original population of M. incognita. At 45 days after inoculation, all inoculated plants developed gall symptoms on the roots similar to those in the field. And five non-inoculated maize seedlings showed no symptoms. Females dissected from inoculated plants were identified to be M. incognita with species-specific primers IncK-14F/IncK-14R (Randig et al., 2002). According to consultation, in the same field root-knot nematode infected carrots were harvested in November last year, the field was left unploughed until March when maize was sowed. As Dali County locates in north temperate zone with a warm temperate climate, where the average annual temperature is 14.4°C, and the highest and lowest temperature was 18°C and -9°C in last winter, the overwintering rate of M. incognita in open field in such area needs further study.

Gynostemma pentaphyllum, belonging to Cucurbitaceae, is a herbaceous climbing plant with multiple medicinal values (Li et al., 2019). It has been planted in Pingli County (109.35 E, 32.39 N), Ankang, Shaanxi province, China for a long history with more than 3000 ha per year. In April 2021, typical root-knot nematode disease symptoms, stunting and galled roots with massive egg masses, were observed on local G. pentaphyllum plants in several gardens. Meloidogyne females and egg masses were dissected from the infected roots. The female was spherical in body shape with a project neck; the excretory pore was at level of or posterior to stylet knobs, 10-20 annules behind head; the perineal pattern had a high dorsal arch, sometimes square or trapezoidal in shape, without obvious lateral lines. The male head was not offset with body, head cap was of stepped outline and concaved at center of top end in lateral view; stylet knobs were prominent, usually demarcated from shaft. Morphological measurements of females (n=20) were: body length (L)= 851.78 ± 83.55 µm (700.15 µm to 986.48 µm); maximum body width (W)= 633.11 ± 71.69 µm (453.09 µm to 746.31 µm); stylet length (ST)= 14.81 ± 0.69 µm (13.31 µm to 15.76 µm); stylet knob height (STKH)= 1.54 ± 0.09 µm (1.45 µm to 1.81 µm); stylet knob width (STKW)= 3.61 ± 0.11 µm (3.38 µm to 3.87 µm); and distance from dorsal esophageal gland opening to the stylet (DGO)= 3.56 ± 0.13 µm (3.28 µm to 4.90 µm). Measurements of males (n=20) were: L=1756.96 ± 67.81 µm (1643.58 µm to 1862.14 µm); W=55.37 ± 1.28 µm (53.46 µm to 57.66 µm); ST= 22.75 ± 1.05µm (19.14 µm to 24.88 µm); STKH= 2.59 ± 0.14 µm (2.45 µm to 2.72 µm); STKW= 3.66 ± 0.13 µm (3.27 µm to 3.91 µm); and DGO= 3.52 ± 0.18 µm (3.38 µm to 4.72 µm). Measurements of second-stage juveniles (J2) (n=20) were: L= 418.99 ± 22.04 µm (376.89 µm to 450.66 µm); W= 14.77 ± 1.15 µm (13.03 µm to 17.77 µm); ST= 12.84 ± 0.45µm (12.05 µm to 13.75 µm); STKH= 1.44 ± 0.13 µm (1.14 µm to 1.71 µm); STKW= 2.25 ± 0.23 µm (1.81 µm to 2.76 µm); and DGO= 1.81 ± 0.31 µm (0.38 µm to 2.56 µm). The morphological characteristics of this nematode were consistent with Meloidogyne incognita (Kofoid and White, 1919) Chitwood, 1949 (Williams, 1973; Eisenback and Hirschmann, 1981). Identification was further confirmed with DNA extracted from 20 individual females. Part of the rDNA spanning internal transcribed spacer (ITS) 1, 5.8S gene, and ITS2 was amplified with the pair of primers: rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). A 768 bp fragment (GenBank Accession No. MZ613806) was obtained, showing 100% identical (768 bp to 768 bp) to the known sequences of M. incognita (GenBank Accession Nos. MH113856, KC464469, and MT921010). Species identification was also confirmed by amplifying part of the NADH dehydrogenase subunit 5 (nad5) from mitochondrial DNA with primers: NAD5-F/R (TATTTTTTGTTTGAGATATATTAG/CGTGAATCTTGATTTTCCATTTTT) (Janssen et al., 2016). The resulting 611 bp fragment was deposited in GenBank with Accession No. MZ613807. The fragment showed a highest identity of 99.67% (601 bp out of 611 bp) with sequences from other M. incognita isolates (GenBank Accession Nos. MW759707, MW759706, MW759705). Based on both morphological and molecular data, the root-knot nematode from G. pentaphyllum was identified as M. incognita. A pathogenicity test was carried out by inoculating 1500 J2 hatched from the egg masses dissected from the diseased roots to a 4-weeks-old healthy G. pentaphyllum seedling cultured in sterilized sandy soil in pot, 15 plants were inoculated and 5 non-inoculated plants served as controls. After maintained at 25°C for 6 weeks, all of the inoculated plant roots showed galling symptoms which were similar to those observed in the field. Nematodes were collected from root and soil, and an average reproduction factor value of 3.51 was obtained. While no galls were observed on the control plants. For further confirmation, all egg masses dissected from inoculated plants were identified to be M. incognita with its sequence specific primers Mi-F/Mi-R (GGGCAAGTAAGGATGCTCTGAC/CTTTCATAGCCACGTCGCGATC) (Ray et al., 1994). In this study, G. pentaphyllum has been identified as a new host of M. incognita, hence the occurrence status and control of root-knot disease on G. pentaphyllum caused by this pathogen would be new problems in production and need further study.

Macrophage migration inhibitory factor (MIF), named for its role in inhibiting macrophage/monocyte migration, has multiple functions in modulation of inflammation, cell proliferation, angiogenesis, and tumorigenesis in vertebrates. Although homologs of this gene can be found in plants, the function of MIF in plants remains obscure. Here, we characterized TaMIF1 in Triticum aestivum resembling the MIF secreted from Homo sapiens. Transcript analysis revealed that TaMIF1 responded to stripe rust infection of wheat and was upregulated during the infection stage. TaMIF1 was localized to both the cytosol and nuclei in wheat mesophyll protoplast. Additionally, TaMIF1 possessed significant tautomerase activity, indicating conservation of MIFs across kingdoms. Agrobacterium tumefaciens infiltration assay demonstrated that TaMIF1 was capable of suppressing programmed cell death hinting its role in plant immunity. Heterologous expression of TaMIF1 increased fission yeast sensitivity to oxidative stress. Silencing TaMIF1 decreased the susceptibility of wheat to Pst seemingly through increasing reactive oxygen species accumulation. In conclusion, functions of the TaMIF1 were investigated in this study, which provides significant insight into understanding the role of MIFs across kingdoms.