Xin Wen

Despite the recognized involvement of TTC39 family genes in metabolism related to pigment deposition, their evolutionary features and potential roles in body coloration in teleost fish remain largely unexplored. We identified three TTC39 genes in Plectropomus leopardus, conserved domains, and evolutionary relationships. The three genes (TTC39A, TTC39B, and TTC39C) were mapped to different chromosomes, yet they shared similar conserved protein domains. Phylogenetic and collinearity analyses indicated that TTC39 genes are evolutionarily conserved among Danio rerio. Gene structure and motif analyses further highlighted the homology and distributional diversity within the TTC39 family. Quantitative expression assays comparing red and black skin revealed significant upregulation of TTC39A and TTC39B in red skin, suggesting that these genes play a role in regulating skin color. These findings provide a foundation for future studies examining how TTC39 genes regulate red skin coloration in P. leopardus.

Two rearing systems are used for Plectropomus leopardus: sea-cage culture and the land-based flow-through aquaculture system. Cages approximate natural conditions and yield many high-quality eggs but offer limited control over ovarian development; the land-based system is highly controllable yet ovaries develop slowly and seldom reach full maturity. We compared these systems by analyzing growth–gonad relationships, monthly hormone profiles (GnRH, E2, GnIH), and hypothalamic transcriptomes in 14- and 18-month-old females. Within each system, body weight did not predict gonadal stage and energy allocation was size-independent. In cages, ovaries reached full maturity with normal histology; in tanks, gonads of all sizes remained at stage III, indicating arrested development. Serum GnRH and E2 displayed parallel increases from 12 to 14 months, declined at 16 months and surged at 18 months in both systems, while GnIH fluctuated inversely, suggesting antagonistic control. Transcriptome analysis identified fshr, cyp11a1 and sox17 as key down-regulated genes in tank-reared fish. KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway enrichment implicated GnRH, oxidative phosphorylation, ribosome and Wnt pathways in ovarian progression. These findings elucidate reproductive constraints under artificial conditions and provide molecular targets for controllable breeding of P. leopardus.

Plectropomus leopardus is a marine fish species with high economic value, and its market price is related to its body coloration. During artificial aquaculture, as the farming scale expands, environmental fluctuations often induce stress responses in P. leopardus , leading to gradual darkening or blackening of body coloration. This discoloration reduces the species’ commercial value and has become a major factor limiting the sustainable and rapid development of the P. leopardus aquaculture industry. This study used molecular cloning, RNA interference (RNAi), yeast two-hybrid assays, and co-immunoprecipitation experiments to validate the effects of jnk1 and p38 genes on body coloration. The dsRNA was successfully synthesized, and the optimal injection dosage and interference duration were determined, providing technical support for subsequent functional studies of the jnk1 and p38 genes. Yeast two-hybrid assays revealed that the jnk1 and mitf proteins could be co-expressed in the yeast system, whereas no expression was detected between p38 and mitf in yeast. Furthermore, co-immunoprecipitation (Co-IP) analysis confirmed the interaction between jnk1 and mitf proteins, as Western blot detection following immunoprecipitation revealed clear signals for both jnk1 and mitf in the IP group. Following RNAi of jnk1 and p38 , the expression levels of melanogenesis-related genes, including microphthalmia-associated transcription factor ( mitf ), dopachrome tautomerase ( dct ), melanocortin 1 receptor ( mc1r ), and tyrosinase ( tyr ), were significantly downregulated. Among these, dct showed the most pronounced decrease, with an 80% reduction following jnk1 -dsRNA injection and a 50% reduction after p38 -dsRNA injection. Both yeast two-hybrid and co-immunoprecipitation results showed that jnk1 interacted with mitf , suggesting a direct involvement of jnk1 in the regulation of body coloration in P. leopardus . A direct interaction was identified between jnk1 and mitf , and the binding of jnk1 to mitf was found to modulate mitf activity, thereby regulating the transcription of downstream melanogenesis-related genes and influencing the melanin biosynthesis process in P. leopardus . This study not only enriches the theoretical understanding of body color variation in P. leopardus but also provides a valuable reference for further investigating the functional roles and potential applications of jnk1 and p38 in the regulation of melanogenesis.

Understanding the molecular mechanism of melanogenesis in Plectropomus leopardus is important for exploring the pattern of skin colour variation in grouper. The research team conducted a combined transcriptomic and proteomic analysis of P. leopardus skin tissues in red-skinned and black-skinned fish and found that the common differences were reflected in the melanogenesis pathway. Therefore, to further investigate the molecular mechanism of melanogenesis in P. leopardus, the full-length sequences of the erk1/2 and mitf genes were obtained in this study using the RACE technique. Through structure-function analysis and differential expression in different red-skinned and black-skinned P. leopardus tissues, it was found that the MAPK signalling pathway may be involved in skin colour changes in P. leopardus, and when erk1/2 expression was decreased in P. leopardus, mitf expression increased accordingly. On the one hand, through short-term in vivo injection of erk1/2-dsRNA, the optimal interference primer for experimented fish was found to be group D: F2R1(F2: TAATACGACTCACTATAGGGATCAACGACATTCTCAGGGC; R1: TAATACGACTCACTATAGGGTCCATGGAGAAAGTGAAGGG), the optimal injection site was the tail vein, the optimal interference concentration was 5 µg/g, and the duration of the interference effect was 5 days. The results of long-term interference showed that when erk1/2 expression was decreased in P. leopardus, the skin colour of the treats fish then darkened, which indicated that ERK1/2 was involved in the regulation of melanogenesis. On the other hand, in vitro Co-Immunoprecipitation (Co-IP) results showed that there was a direct or indirect interaction between MITF and ERK1/2 proteins. In conclusion, this is the first time that an interaction between ERK1/2 and MITF, which indicated that ERK1/2 was involved in the regulation of melanogenesis through the regulation of MITF in P. leopardus. These results further enrich our understanding of the theoretical basis of the changing pattern of skin colour in P. leopardus and provides a new perspective for exploring the variable skin colouration of coral reef fish.

The velocity of water can cause differences in the growth of inhabitant fish, thereby functioning as an important aquatic environmental factor. In order to explore the response mechanism of Leopard Coralgrouper (Plectropomus leopardus) under different flow velocities, P. leopardus fish of the same sizes were fed in water characterized by three different flow rates (5 cm/s, 10 cm/s, and 20 cm/s) for 150 d, after which the differences in growth and the levels of liver oxidative stress kinase were analyzed. Additionally, potential underlying regulatory pathways were explored using comparative transcriptomic approaches. The results showed that in the feeding environment involving a flow rate of 10 cm/s, the weight increase of P. leopardus and its liver contents of glutathione peroxidase (GPX), alanine aminotransferase (ALT), and superoxide dismutase (T-SOD) were significantly higher than for the other two groups. After matching the comparative transcriptomic results between group pairs (5 cm/s and 10 cm/s, 5 cm/s and 20 cm/s, and 10 cm/s and 20 cm/s), a total of 225 common differential gene expressions were screened. The KEGG pathway enrichment analysis showed that these genes were mainly involved in protein processing in the endoplasmic reticulum, the TGF-β signaling pathway, fatty acid metabolism, fatty acid synthesis, and other pathways. These results not only provide a theoretical basis for the selection of flow velocity in the culture environment of P. leopardus, but also reveal its potential means of adaption to different flow velocities.

T. fasciatus (Takifugu fasciatus) faces the same problem as most warm water fish: the water temperature falls far below the optimal growth temperature in winter, causing a massive death of T. fasciatus and large economic losses. Understanding of the cold-tolerance mechanisms of this species is still limited. Integrated application of multi-omics research can provide a wealth of information to help us improve our understanding of low-temperature tolerance in fish. To gain a comprehensive and unbiased molecular understanding of cold-tolerance in T. fasciatus, we characterized mRNA-seq and metabolomics of T. fasciatus livers using Illumina HiSeq 2500 and UHPLC-Q-TOF MS. We identified 2544 up-regulated and 2622 down-regulated genes in the liver of T. fasciatus. A total of 40 differential metabolites were identified, including 9 down-regulated and 31 up-regulated metabolites. In combination with previous studies on proteomics, we have established an mRNA-protein-metabolite interaction network. There are 17 DEMs (differentially-expressed metabolites) and 14 DEGs-DEPs (differentially co-expressed genes and proteins) in the interaction network that are mainly involved in fatty acids metabolism, membrane transport, signal transduction, and DNA damage and defense. We then validated a number of genes in the interaction network by qRT-PCR. Additionally, a number of SNPs (single nucleotide polymorphisms) were revealed through the transcriptome data. These results provide key information for further understanding of the molecular mechanisms of T. fasciatus under cold stress. The data generated by integrated application of multi-omics can facilitate our understanding of the molecular mechanisms of fish response to low temperature stress. We have not only identified potential genes and SNPs involved in cold tolerance, but also show that some nutrient metabolites may be added to the diet to help the overwintering of T. fasciatus.