John C. Palumbo

The diamondback moth, Plutella xylostella L. (Lepidoptera: Plutellidae), is a major pest affecting Brassica crops worldwide. In North America, P. xylostella outbreaks have caused substantial economic losses in canola (Brassica napus L. and Brassica rapa L.) and brassicaceous vegetable (Brassica oleracea L.) crops. Natural enemies, including the parasitoid Diadegma insulare (Hymenoptera: Ichneumonidae), play a key role in controlling P. xylostella populations. To better understand the distribution and impact of Diadegma spp., we adopted Diadegma-specific primers, developed originally for haplotyping, and used a molecular screening approach to detect parasitism of P. xylostella larvae collected across Canada and the United States. The primer set was first tested on D. insulare adults and laboratory parasitized P. xylostella to confirm amplification and specificity and determine sensitivity. Screening was then conducted on 421 field-collected larvae from 45 localities to detect and estimate parasitism rates and assess geographic variability. The results revealed notable variation across collection sites in parasitism of P. xylostella larvae by Diadegma spp., with more parasitized larvae collected from field sites in Canada than from field sites in the United States. Variation in parasitism across collection sites could be the result of differences in climate, agricultural practices, and insecticide use between agricultural systems. This research demonstrates the utility of molecular screening to detect parasitism of P. xylostella larvae and highlights potential differences in the impact of Diadegma spp. on the population dynamics of P. xylostella in Canada and the United States.

Watermelon (Citrullus lanatus) and melon (Cucumis melo) plants with leaves exhibiting mosaic symptoms or chlorotic spotting, respectively, along with limited foliar distortion, predominantly on newer growth, were observed in commercial fields throughout Yuma County, AZ, and Imperial County, CA, in fall 2023. Older leaves also exhibited yellowing typical of infection by whitefly-transmitted viruses common in the region, and whiteflies (Bemisia tabaci) were prevalent in fields. Symptomatic plants were tested using a multiplex RT-PCR for cucurbit yellow stunting disorder virus (CYSDV), cucurbit chlorotic yellows virus (CCYV), squash vein yellowing virus (SqVYV), and cucurbit aphid-borne yellows virus (CABYV) (Mondal et al., 2023), and separately for cucurbit leaf crumple virus (CuLCrV; F: TCAAAGGTTTCCCGCTCTGC, R: TCAAAGGTTTCCCGCTCTGC). Most plants were infected with CYSDV, which has been widely prevalent during the fall production season since its emergence in 2006, but not with the other tested viruses. Although the yellowing of older leaves near the crown was typical of symptoms resulting from CYSDV infection, the unusual symptoms on newer growth suggested the possibility of infection by a begomovirus. Rolling circle amplification and DNA sequencing of nucleic acid extract from a symptomatic melon plant collected in Dome Valley, AZ, identified the presence of watermelon chlorotic stunt virus (WmCSV), a bipartite begomovirus (Geminiviridae) (Jones et al., 1988; Lecoq, 2017), but no other begomoviruses. Sequencing of the complete WmCSV genome from this melon plant determined that DNA A (GenBank accession #PQ399661) shared 99% identity with WmCSV isolates from cactus (MW588390) and melon (KY124280) in Sonora, Mexico, and DNA B (PQ399662) shared 96% and 94% identity with WmCSV isolates from watermelon in Palestine (KC462553) and Sonora (KY124281), respectively. PCR with primers targeting WmCSV DNA A (F: CATGGAGATGAGGTTCCCCATTCT and R: GCTCGTAGGTCGATTCAACGGCCT) and DNA B (F: AGATACAACGTATGGGCAGCATT and R: TACAGATCCCARTCGATGAGACT) was used for secondary confirmation. Sequencing of amplified products confirmed both WmCSV DNA A and B in 12/15 initial melon samples. PCR using the DNA A or B primers confirmed the presence of WmCSV from additional watermelon and melon samples collected from Yuma County (31 positive/37 tested) and Imperial County (20/22). This is the first report of WmCSV in cucurbits in the United States (U.S.); the virus was previously identified in watermelon (Domínguez-Durán et al., 2018) and cactus (Opuntia auberi) from Sonora, Mexico, and from one cactus (O. cochenillifera), lamb's ears (Stachys byzantine), and an unknown Solanum plant from a botanical garden in Arizona (Fontanelle et al., 2021). The geographic distribution of WmCSV and the presence of similar symptoms in melon in 2022 suggests that it may have been present in the U.S. for at least a year. Interestingly, nearly all melon and some watermelon plants infected with WmCSV were co-infected with CYSDV. Most fall cucurbits in the Sonoran Desert production region become infected with CYSDV, and many are also infected with CCYV and/or SqVYV (Mondal et al., 2023). However, incidence of CCYV (4/63) and SqVYV (2/63) in the region was extremely low during fall 2023. Research is in progress to determine the potential impact of WmCSV on the cucurbit virus complex in the Sonoran Desert and the U.S. as a whole, and to understand the epidemiological factors that influence WmCSV infection and spread.

The diamondback moth, Plutella xylostella (Linnaeus), is one of the most important insect pests of Brassica crops worldwide. In October 2016, outbreaks of an invasive P. xylostella population and unexpected control failures occurred on broccoli and cauliflower crops throughout all vegetable-growing regions in Arizona. Nineteen populations of Plutella xylostella were collected from 2016 to 2021 from various commercial cauliflower fields in Yuma and Scottsdale, Arizona, and from experimental broccoli plots at the University of Arizona, Yuma Agricultural Center (UAYAC), Yuma, Arizona. Populations collected from the commercial cauliflower fields had been transplanted with seedlings produced in a local Yuma nursery in 2016 and Salinas, CA in 2017 to 2018, whereas experimental broccoli plots were direct seeded. These populations were evaluated for their susceptibility to chlorantraniliprole, spinetoram, emamectin benzoate, and cyantraniliprole. In this study, field rate laboratory bioassays, serial dilution laboratory bioassays, and field efficacy spray experiments were performed. The field rate laboratory bioassay results showed that spinetoram, emamectin benzoate, and cyantraniliprole remained effective at controlling P. xylostella, but chlorantraniliprole did not control P. xylostella at the field rate. Additionally, serial dilution bioassays confirmed significant levels of cyantraniliprole and chlorantraniliprole resistance in the P. xylostella populations collected from transplanted cauliflower fields. However, the results of the multiyear/growing-seasons study monitoring the susceptibility of P. xylostella populations collected from direct-seeded broccoli and field efficacy trials conducted at the UAYAC indicated that the resistance to diamide insecticides was neither uniform nor persistent following the 2016 outbreak. Nevertheless, the risk for P. xylostella resistance in Arizona vegetable-growing regions exists, particularly in Brassica transplants. Therefore, we recommend that Arizona Brassica growers remain vigilant and practice rigorous insecticide resistance management to offset the development of resistance.

Tomato spotted wilt virus (TSWV, family Tospoviridae, genus Orthotospovirus) is a thrips-vectored pathogen that infects lettuce (Lactuca sativa) and many vegetable crops (Kuo et al. 2014, Hasegawa ...

In 2021 and 2022, wilt symptoms were observed in lettuce (Lactuca sativa L.) fields in Yuma County, Arizona (AZ). Incidence was < 1% at all locations. Symptoms included stunting, yellowing and wilting of outer leaves. As disease progressed, outer leaves wilted and turned necrotic. In advanced stages, tap roots turned brown-gray, with few feeder roots. The crown remained intact until the plant collapsed. Symptomatic romaine and iceberg plants were collected from two sites. Necrotic roots were washed and then plated on amended corn meal agar (PARP) (Kannwischer et al. 1978). After 2-3 days, slow growing, coenocytic, submerged mycelia grew from these pieces. In culture, profuse oogonia formed with diameters of 30-39 (avg. = 33.7) µm and spiny protuberances (5-8 [avg. = 6.4] µm long) with thickened bases. Oospores were spherical and aplerotic, with diameters of 25-32 (avg. = 27.8) µm. Lettuce with identical symptoms from the Salinas Valley, California (CA) were also tested and similar isolates were recovered. Pathogenicity was tested using six AZ and one CA isolates. Inoculum was grown on barley seeds moistened with sterile distilled water, autoclaved three times (at 24 h intervals), then inoculated with colonized agar plugs and incubated at 20°C. Inoculum was used after two weeks. For each isolate, 12 3-week-old iceberg (cv. Speedway) and romaine (cv. Del Sol) plants were inoculated by placing 3-4 colonized barley seed next to the roots of the potted plants. Plants were maintained in a greenhouse at 24-26°C (daytime high) with ambient light. After eight days, all inoculated plants exhibited chlorotic lower leaves that later wilted. Both feeder roots and taproots showed brown-gray discoloration and were necrotic. Microscopy showed the presence of spiny oogonia in inoculated roots. Symptoms caused by the AZ and CA isolates were indistinguishable from each other. Isolations from necrotic tissue resulted in colonies morphologically identical to the original isolates. Twelve control plants inoculated with uncolonized barley seed developed no symptoms. DNA was extracted from all seven AZ and CA isolates pre-inoculation, and AZ isolate 2 recovered from both lettuce types post-inoculation for molecular characterization. The internal transcribed spacer (ITS) and cytochrome C oxidase subunit 2 (COX II) were amplified for the above isolates using primer sets ITS1/ITS4 (White et al. 1990) and FM66/FM58 (Villa et al. 2006), then sequenced. ITS of pre- and post-inoculated isolates for AZ (OQ054806 and OQ054807) and CA (OQ564388) matched 1078/1078 bases of Globisporangium uncinulatum (syn. Pythium uncinulatum; AY598712.2) with 99.8% identity. There were two SNPs in COX II for AZ isolate 1 (OR069239); all other isolates pre- and post- inoculation for AZ (OR069240 and OR069242) and CA (OR069241) uniformly matched 533/535 bases of G. uncinulatum (KJ595385.1) with 99.4% identity. Based on these molecular and morphological data, the isolates were identified as G. uncinulatum (Blok and Van Der Plaats-Niterink 1978; Van Der Plaats-Niterink 1981). To our knowledge, this is the first report of G. uncinulatum on lettuce in AZ. Designated as Pythium wilt, this disease is reported on lettuce in The Netherlands (Blok and Van Der Plaats-Niterink 1978), Japan (Matsuura, et al. 2010), and CA (Davis, et al. 1995). Arizona is an important lettuce growing region; if this disease becomes more prevalent, lettuce production in this region could be negatively impacted.

The objective of this trial was to evaluate the efficacy of clothianidin (NipsIt; Valent USA) seed treatment to control western flower thrips (WFT) in lettuce under desert growing conditions. Commercially treated with clothianidin and untreated romaine lettuce ‘Del Sol’ seed was direct seeded on 23 Feb 2022 at the Yuma Agricultural into beds on 42-inch centers with 2 seed lines per bed. All seeds were planted at a 2-inch spacing. Stand establishment was achieved using overhead sprinklers and irrigated with furrow irrigation thereafter. Plots were 2 beds wide by 35 ft long and bordered by 2 untreated beds. Four replications of each treatment were arranged in an RCB design. No other insecticides were applied during the trial.

The objective of this trial was to evaluate the efficacy of soil-applied, systemic insecticides to control western flower thrips in lettuce under desert growing conditions. Romaine lettuce ‘Del Sol’ seed was direct seeded on 23 Feb 2022 at the Yuma Agricultural Center into beds on 42-inch centers with 2 seed lines per bed. All seed was planted at a 2-inch spacing. Stand establishment was achieved using overhead sprinklers and irrigated with furrow irrigation thereafter. Plots were 2 beds wide by 35 ft long and bordered by 2 untreated beds. Four replications of each treatment were arranged in an RCB design. Formulations and rates for each compound are provided in the tables. All treatments were applied to the soil at planting as a subsurface soil injection (SSI). The SSI treatments were injected 1.5 inches below each seedline at planting using a modified fertilizer shank in a total water volume of 20.5 GPA. No additional insecticide applications were applied during the trial.

The objective of the trial was to compare the efficacy of 2 soil-applied, systemic insecticides to control western flower thrips and lettuce aphid under desert growing conditions. Romaine lettuce ‘Del Sol’ was direct seeded on 1 Mar 2023 at the Yuma Agricultural Center into beds on 42-inch centers with 2 seed lines per bed. Stand establishment was achieved using overhead sprinklers and irrigated with furrow irrigation thereafter. Plots were 2 beds wide by 45 ft long and bordered by 2 untreated beds. Four replications of each treatment were arranged in an RCB design. Formulations and rates for each compound are provided in the tables. Subsurface, soil injection application of each treatment was applied by placing the insecticides 1.5 inches directly below each seed line with a modified fertilizer shank just prior to planting in a total water volume of 20.5 gpa. No other insecticides were applied during the trial. Numbers of WFT from 5 plants per replicate were recorded at 7-day intervals beginning 21 days after planting (DAP).

The objective of this study was to evaluate the contact efficacy of several insecticides against DBM adults. The laboratory bioassay was conducted at the University of Arizona, Yuma Agricultural Center (YAC), Yuma, Arizona on 17 Dec 2019. Moths used in the assays were reared from fourth-instar larvae collected from an infested cauliflower field on 8 Dec 2019. Larvae pupated after feeding on artificial diet and cohorts of pupae were collected and placed into Petri dishes (9 cm) where adults emerged and provided a mixture of water and molasses as a food source. The bioassay consisted of taking 2-day-old adults and holding them in dishes in a walk-in refrigerator (40 °F) for 1 h to slow down insect activity and movement. The Petri dishes were then placed outside of the laboratory on a soil surface where the Petri dish lids were quickly removed, and the adults were treated within each dish with field equivalent rates of each insecticide. Adults were sprayed topically in the dish where spray droplets directly contacted them. The following active ingredients were evaluated: lambda-cyhalothrin (Warrior II), acetamiprid (Assail 30DG), chlorantraniliprole (Coragen 1.67SC), emamectin benzoate (Proclaim 5SG), spinetoram (Radiant SC), chlorpyrifos (Lorsban Advanced), methomyl (Lannate SP), and naled (Dibrom 8E). Insecticides were applied using a CO₂ operated back-pack sprayer delivering 22.5 gpa at 40 psi with a 42” in boom with a 21” spacing of 2, TXVS-18 hollow cone nozzles by walking directly over the dishes comparable to how plants in small plot efficacy trials are treated. Adults in the control dishes were treated with water only. Immediately following each spray, lids were replaced on the petri dishes and transferred to an environmental chamber at 30 °C with a photoperiod of 12:12 h (light:dark) in an RCBD arrangement. Eight replicates of each treatment with 5 DBM (n = 40 adults/treatment) were treated. Adult mortality was assessed by counting the number of dead adults (unresponsive to touch) in each dish at 24 and 48 h following treatment. Analysis of variance was performed (PROC GLM; SAS Institute 2009) to compare the differences among insecticide treatments. The response variable (percentage mortality) was subjected to arcsine square root transformation before analysis. Means were compared using Turkey’s HSD test (P ≤ 0.05). Mean percentages from nontransformed data are presented in the tables.