Yiyan Zhu

Alterations in the RAS pathway underscore the pathogenic complexity of acute myeloid leukemia (AML), yet the full spectrum, including CBL, NF1, PTPN11, KRAS, and NRAS, remains to be fully elucidated. In this retrospective study of 735 adult AML patients, the incidence of RAS pathway alterations was 32.4%, each with distinct clinical characteristics. Venetoclax combined with hypomethylating agents (VEN + HMA) did not significantly improve response rates compared to intensive chemotherapy (IC) group. In the IC group, PTPN11 mutations in the N-SH2 domain showed a trend toward poorer prognosis, though not statistically significant in multivariate analysis, while NRAS mutations correlated with improved outcomes. In the VEN + HMA group, PTPN11 mutations in the N-SH2 domain emerged as an independent adverse prognostic marker. NRAS or KRAS mutations showed no survival advantage compared to wild-type, aligning with their intermediate-risk classification in the 2024 ELN guidelines. These findings emphasize the need for treatment-specific risk stratification for RAS pathway mutations in AML.

Hematological malignancies often involve chromosomal translocations and fusion genes that drive disease progression. While MTCP1 is well-known in T-cell prolymphocytic leukemia (T-PLL), its role in myeloid neoplasms is less understood. This report presents the first identification of the t(X;1)(q28;q21) translocation leading to the GATAD2B::MTCP1 fusion in acute myeloid leukemia (AML) transformed from chronic myelomonocytic leukemia (CMML). The karyotypes were described according to the International System for Human Cytogenetic Nomenclature 2009. We performed targeted next-generation sequencing (NGS) on a panel of 172 genes commonly mutated in hematological malignancies (Supplemental Table 1), using an Illumina platform. RNA sequencing was conducted on total RNA extracted from bone marrow, also using the Illumina platform. The GATAD2B::MTCP1 fusion gene was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) and Sanger sequencing, with specific primers for the fusion transcript (GATAD2B-F: CCTCTTTTTTTCGACGCC; MTCP1-R: ACTGAGCACAACACTTACGC). The GATAD2B::MTCP1 fusion results from a breakpoint on 1q21 within GATAD2B exon 1 and Xq28 within MTCP1 exon 2. The patient with the GATAD2B::MTCP1 fusion exhibited disease progression from CMML to AML. Despite achieving initial remission with venetoclax-based therapy and allo-HSCT, the patient relapsed and died. We propose that the GATAD2B::MTCP1 fusion upregulates MTCP1 expression rather than generating a fusion protein, thereby contributing to transformation and relapse in AML. Further investigations are needed to elucidate the precise role of this fusion event in myeloid malignancies.